Incidental Mutation 'R4710:Coro7'
ID353233
Institutional Source Beutler Lab
Gene Symbol Coro7
Ensembl Gene ENSMUSG00000039637
Gene Namecoronin 7
Synonyms0610011B16Rik
MMRRC Submission 042019-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.089) question?
Stock #R4710 (G1)
Quality Score225
Status Validated
Chromosome16
Chromosomal Location4626133-4679777 bp(-) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) T to G at 4634933 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000118310 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038552] [ENSMUST00000135823]
Predicted Effect probably benign
Transcript: ENSMUST00000038552
SMART Domains Protein: ENSMUSP00000048489
Gene: ENSMUSG00000039637

DomainStartEndE-ValueType
DUF1899 3 64 6.41e-15 SMART
WD40 66 106 1.83e-7 SMART
WD40 115 154 4.13e0 SMART
WD40 157 196 1.78e-5 SMART
DUF1900 251 385 4.49e-60 SMART
low complexity region 427 456 N/A INTRINSIC
DUF1899 463 528 1.2e-19 SMART
WD40 531 570 3.64e-2 SMART
WD40 580 620 8.55e-8 SMART
WD40 623 662 1.16e-9 SMART
low complexity region 667 679 N/A INTRINSIC
DUF1900 718 854 6.69e-68 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127125
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130125
Predicted Effect probably benign
Transcript: ENSMUST00000135823
SMART Domains Protein: ENSMUSP00000118310
Gene: ENSMUSG00000039637

DomainStartEndE-ValueType
DUF1899 3 64 6.41e-15 SMART
WD40 66 106 1.83e-7 SMART
WD40 115 154 4.13e0 SMART
WD40 157 196 1.78e-5 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139072
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143723
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151156
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.5%
Validation Efficiency 99% (75/76)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele are viable and overtly normal but exhibit disruption of the Golgi apparatus. Mutant fibroblasts show increased cell spreading and cellular F-actin content, increased cell polarization and migration, and enhanced wound healing in a scratch-wound assay. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2m A T 6: 121,641,303 Q185L probably benign Het
Acaca T A 11: 84,392,337 I2243N possibly damaging Het
Adamts18 A G 8: 113,706,926 S1059P probably damaging Het
Aox4 A T 1: 58,255,638 K1002M probably damaging Het
Ap1b1 A G 11: 5,031,664 Y524C probably damaging Het
Bag4 C T 8: 25,769,488 A228T probably benign Het
Bpifb6 T A 2: 153,908,516 I309N possibly damaging Het
Cd209b T C 8: 3,924,215 E99G probably damaging Het
Cntn2 T A 1: 132,528,225 H185L possibly damaging Het
Col4a2 C A 8: 11,409,462 P299Q probably benign Het
Commd3 A G 2: 18,674,282 N106S probably benign Het
Ctf1 C A 7: 127,717,080 P66Q probably damaging Het
Dclre1c T C 2: 3,440,861 probably null Het
Dnaaf3 A T 7: 4,526,494 L317Q probably damaging Het
Dnah2 A G 11: 69,478,077 L1667P probably damaging Het
Dpp4 A G 2: 62,360,315 I399T probably benign Het
Dysf C A 6: 84,097,715 D499E probably damaging Het
Erg T C 16: 95,390,034 D90G possibly damaging Het
F11 T C 8: 45,250,146 Y169C probably damaging Het
Fabp3 C T 4: 130,312,387 T57I probably benign Het
Fcgbp A T 7: 28,094,961 M1197L probably benign Het
Gimd1 T C 3: 132,634,848 S42P possibly damaging Het
Gm12666 T C 4: 92,190,975 E203G possibly damaging Het
Gm5526 T A 1: 45,857,419 noncoding transcript Het
Gnl2 T A 4: 125,053,459 S625T probably benign Het
H2-Q2 A G 17: 35,343,302 E175G probably damaging Het
Hmgxb3 G A 18: 61,137,475 P926S probably damaging Het
Ifi213 G A 1: 173,567,172 probably benign Het
Inhba T C 13: 16,026,483 V210A probably benign Het
Kansl1l G A 1: 66,801,496 A215V possibly damaging Het
Kcnk1 T A 8: 126,029,528 V263D probably damaging Het
Kcnk9 A G 15: 72,512,975 I118T probably damaging Het
Lamb1 A G 12: 31,282,583 I283V probably benign Het
Lias A G 5: 65,397,727 D88G probably benign Het
Lrrk2 G A 15: 91,699,927 V297M possibly damaging Het
Maea C T 5: 33,368,690 R237C probably benign Het
Mdfi T A 17: 47,824,586 N73I probably damaging Het
Mphosph6 T A 8: 117,801,902 M1L probably damaging Het
Mta2 T A 19: 8,949,153 I486N probably damaging Het
Nbr1 C T 11: 101,575,275 P769L probably damaging Het
Ncam2 T A 16: 81,465,706 probably null Het
Ndel1 A G 11: 68,845,337 Y26H probably damaging Het
Neb T C 2: 52,260,598 R2473G probably benign Het
Olfr1115 T A 2: 87,252,040 D34E possibly damaging Het
Olfr140 T C 2: 90,052,150 Y58C probably damaging Het
Olfr187 T A 16: 59,036,275 H154L possibly damaging Het
Olfr213 T C 6: 116,540,650 Y66H possibly damaging Het
Olfr325 A T 11: 58,581,722 I293F probably damaging Het
Olfr459 G T 6: 41,771,508 Q264K probably benign Het
Park2 A C 17: 11,854,833 Q346P possibly damaging Het
Prrc2b T A 2: 32,193,857 S236R possibly damaging Het
Rae1 G T 2: 173,015,392 probably benign Het
Rnf112 T C 11: 61,449,831 D491G probably damaging Het
Rnf220 C T 4: 117,289,214 probably benign Het
Ryr3 G A 2: 112,766,301 L2483F probably damaging Het
Sema6a T C 18: 47,270,683 N624S probably benign Het
Sgms1 C T 19: 32,160,137 V10M probably damaging Het
Slc23a2 T C 2: 132,056,709 N636S probably benign Het
Slc25a48 C T 13: 56,463,566 T162I probably damaging Het
Smtn G A 11: 3,524,663 S716F probably damaging Het
Snrnp200 T C 2: 127,226,133 L850P probably damaging Het
Sost G A 11: 101,966,844 P44S probably damaging Het
Sox18 A G 2: 181,670,895 Y148H probably damaging Het
Stk-ps1 A G 17: 36,397,670 noncoding transcript Het
Tas2r104 T A 6: 131,685,444 T101S probably damaging Het
Traf3ip2 C T 10: 39,639,260 P345S possibly damaging Het
Ttn A G 2: 76,752,084 Y22822H probably damaging Het
Vmn2r4 A G 3: 64,409,780 probably null Het
Vmn2r53 T A 7: 12,601,202 H177L probably benign Het
Zbtb20 G T 16: 43,610,676 A517S probably damaging Het
Zfat A T 15: 68,180,282 D554E probably benign Het
Zfp719 C T 7: 43,590,232 H415Y probably damaging Het
Other mutations in Coro7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00428:Coro7 APN 16 4634636 missense possibly damaging 0.83
IGL00885:Coro7 APN 16 4635026 missense probably benign 0.00
IGL02944:Coro7 APN 16 4635412 missense probably benign 0.14
IGL03104:Coro7 APN 16 4629126 missense probably damaging 1.00
IGL03153:Coro7 APN 16 4635382 critical splice donor site probably null
R0022:Coro7 UTSW 16 4633304 missense probably benign 0.01
R0022:Coro7 UTSW 16 4633304 missense probably benign 0.01
R0071:Coro7 UTSW 16 4670527 missense probably damaging 1.00
R0071:Coro7 UTSW 16 4670527 missense probably damaging 1.00
R0080:Coro7 UTSW 16 4630464 missense probably damaging 1.00
R0193:Coro7 UTSW 16 4627504 unclassified probably benign
R0242:Coro7 UTSW 16 4630178 splice site probably benign
R0318:Coro7 UTSW 16 4675807 missense probably benign 0.09
R0554:Coro7 UTSW 16 4632257 missense possibly damaging 0.63
R0666:Coro7 UTSW 16 4631911 missense possibly damaging 0.70
R0835:Coro7 UTSW 16 4632254 missense probably benign 0.12
R0968:Coro7 UTSW 16 4670055 splice site probably benign
R1670:Coro7 UTSW 16 4628233 missense possibly damaging 0.76
R1709:Coro7 UTSW 16 4634441 splice site probably null
R1848:Coro7 UTSW 16 4630434 missense probably damaging 0.99
R1884:Coro7 UTSW 16 4628819 unclassified probably benign
R1935:Coro7 UTSW 16 4628732 missense probably benign
R1937:Coro7 UTSW 16 4628732 missense probably benign
R1939:Coro7 UTSW 16 4628732 missense probably benign
R1967:Coro7 UTSW 16 4634889 missense probably damaging 1.00
R1969:Coro7 UTSW 16 4633756 missense probably benign 0.19
R1970:Coro7 UTSW 16 4633756 missense probably benign 0.19
R3034:Coro7 UTSW 16 4632291 missense probably damaging 0.99
R4638:Coro7 UTSW 16 4632287 missense probably damaging 0.96
R4723:Coro7 UTSW 16 4631994 missense probably benign 0.00
R4789:Coro7 UTSW 16 4628221 missense probably damaging 1.00
R5493:Coro7 UTSW 16 4632487 missense probably damaging 0.99
R5619:Coro7 UTSW 16 4676935 critical splice donor site probably null
R5756:Coro7 UTSW 16 4632284 missense probably damaging 0.97
R5974:Coro7 UTSW 16 4631889 missense possibly damaging 0.83
R6010:Coro7 UTSW 16 4669956 missense possibly damaging 0.68
R6038:Coro7 UTSW 16 4679550 critical splice donor site probably null
R6038:Coro7 UTSW 16 4679550 critical splice donor site probably null
R6906:Coro7 UTSW 16 4633304 missense probably benign 0.00
R6925:Coro7 UTSW 16 4628674 critical splice donor site probably null
R7069:Coro7 UTSW 16 4679611 start codon destroyed probably damaging 0.99
R7326:Coro7 UTSW 16 4632048 missense probably damaging 0.96
R7421:Coro7 UTSW 16 4668751 missense probably benign 0.19
R7521:Coro7 UTSW 16 4631482 missense probably benign 0.00
R7773:Coro7 UTSW 16 4632006 missense probably damaging 1.00
R7846:Coro7 UTSW 16 4670536 missense probably damaging 1.00
R7929:Coro7 UTSW 16 4670536 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTCATGGAACTCTACAGCCTG -3'
(R):5'- TGGTTGCTGCAGGTCTACAG -3'

Sequencing Primer
(F):5'- CATGGAACTCTACAGCCTGGTGAG -3'
(R):5'- TCTACAGCACATGGTCAGGTG -3'
Posted On2015-10-21