Incidental Mutation 'R4710:Park2'
ID353238
Institutional Source Beutler Lab
Gene Symbol Park2
Ensembl Gene ENSMUSG00000023826
Gene NameParkinson disease (autosomal recessive, juvenile) 2, parkin
SynonymsPRKN
MMRRC Submission 042019-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.208) question?
Stock #R4710 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location10840384-12063361 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 11854833 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Proline at position 346 (Q346P)
Ref Sequence ENSEMBL: ENSMUSP00000140587 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000191124]
PDB Structure
NMR structure of ubiquitin-like domain in murine Parkin [SOLUTION NMR]
Crystal structure of ubiquitin-like domain of murine Parkin [X-RAY DIFFRACTION]
Crystal Structure of parkin ubiquitin-like domain R33Q mutant [X-RAY DIFFRACTION]
Predicted Effect unknown
Transcript: ENSMUST00000179624
AA Change: Q56P
Predicted Effect noncoding transcript
Transcript: ENSMUST00000190849
Predicted Effect possibly damaging
Transcript: ENSMUST00000191124
AA Change: Q346P

PolyPhen 2 Score 0.888 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000140587
Gene: ENSMUSG00000023826
AA Change: Q346P

DomainStartEndE-ValueType
UBQ 1 72 3.58e-15 SMART
Blast:UBQ 203 230 2e-6 BLAST
Blast:RING 237 295 7e-11 BLAST
IBR 312 376 1.2e-14 SMART
IBR 400 456 5.16e-2 SMART
Meta Mutation Damage Score 0.0979 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.5%
Validation Efficiency 99% (75/76)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The precise function of this gene is unknown; however, the encoded protein is a component of a multiprotein E3 ubiquitin ligase complex that mediates the targeting of substrate proteins for proteasomal degradation. Mutations in this gene are known to cause Parkinson disease and autosomal recessive juvenile Parkinson disease. Alternative splicing of this gene produces multiple transcript variants encoding distinct isoforms. Additional splice variants of this gene have been described but currently lack transcript support. [provided by RefSeq, Jul 2008]
PHENOTYPE: Dopamine and glutatamate transmission are impaired in some targeted null mice, resulting in decreased exploratory behavior. These mice show decreased body weight and temperature. Park2 is inactivated as part of a large deletion in the quaking mouse, a dysmyelinating mutant with a pronounced tremor. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2m A T 6: 121,641,303 Q185L probably benign Het
Acaca T A 11: 84,392,337 I2243N possibly damaging Het
Adamts18 A G 8: 113,706,926 S1059P probably damaging Het
Aox4 A T 1: 58,255,638 K1002M probably damaging Het
Ap1b1 A G 11: 5,031,664 Y524C probably damaging Het
Bag4 C T 8: 25,769,488 A228T probably benign Het
Bpifb6 T A 2: 153,908,516 I309N possibly damaging Het
Cd209b T C 8: 3,924,215 E99G probably damaging Het
Cntn2 T A 1: 132,528,225 H185L possibly damaging Het
Col4a2 C A 8: 11,409,462 P299Q probably benign Het
Commd3 A G 2: 18,674,282 N106S probably benign Het
Coro7 T G 16: 4,634,933 probably benign Het
Ctf1 C A 7: 127,717,080 P66Q probably damaging Het
Dclre1c T C 2: 3,440,861 probably null Het
Dnaaf3 A T 7: 4,526,494 L317Q probably damaging Het
Dnah2 A G 11: 69,478,077 L1667P probably damaging Het
Dpp4 A G 2: 62,360,315 I399T probably benign Het
Dysf C A 6: 84,097,715 D499E probably damaging Het
Erg T C 16: 95,390,034 D90G possibly damaging Het
F11 T C 8: 45,250,146 Y169C probably damaging Het
Fabp3 C T 4: 130,312,387 T57I probably benign Het
Fcgbp A T 7: 28,094,961 M1197L probably benign Het
Gimd1 T C 3: 132,634,848 S42P possibly damaging Het
Gm12666 T C 4: 92,190,975 E203G possibly damaging Het
Gm5526 T A 1: 45,857,419 noncoding transcript Het
Gnl2 T A 4: 125,053,459 S625T probably benign Het
H2-Q2 A G 17: 35,343,302 E175G probably damaging Het
Hmgxb3 G A 18: 61,137,475 P926S probably damaging Het
Ifi213 G A 1: 173,567,172 probably benign Het
Inhba T C 13: 16,026,483 V210A probably benign Het
Kansl1l G A 1: 66,801,496 A215V possibly damaging Het
Kcnk1 T A 8: 126,029,528 V263D probably damaging Het
Kcnk9 A G 15: 72,512,975 I118T probably damaging Het
Lamb1 A G 12: 31,282,583 I283V probably benign Het
Lias A G 5: 65,397,727 D88G probably benign Het
Lrrk2 G A 15: 91,699,927 V297M possibly damaging Het
Maea C T 5: 33,368,690 R237C probably benign Het
Mdfi T A 17: 47,824,586 N73I probably damaging Het
Mphosph6 T A 8: 117,801,902 M1L probably damaging Het
Mta2 T A 19: 8,949,153 I486N probably damaging Het
Nbr1 C T 11: 101,575,275 P769L probably damaging Het
Ncam2 T A 16: 81,465,706 probably null Het
Ndel1 A G 11: 68,845,337 Y26H probably damaging Het
Neb T C 2: 52,260,598 R2473G probably benign Het
Olfr1115 T A 2: 87,252,040 D34E possibly damaging Het
Olfr140 T C 2: 90,052,150 Y58C probably damaging Het
Olfr187 T A 16: 59,036,275 H154L possibly damaging Het
Olfr213 T C 6: 116,540,650 Y66H possibly damaging Het
Olfr325 A T 11: 58,581,722 I293F probably damaging Het
Olfr459 G T 6: 41,771,508 Q264K probably benign Het
Prrc2b T A 2: 32,193,857 S236R possibly damaging Het
Rae1 G T 2: 173,015,392 probably benign Het
Rnf112 T C 11: 61,449,831 D491G probably damaging Het
Rnf220 C T 4: 117,289,214 probably benign Het
Ryr3 G A 2: 112,766,301 L2483F probably damaging Het
Sema6a T C 18: 47,270,683 N624S probably benign Het
Sgms1 C T 19: 32,160,137 V10M probably damaging Het
Slc23a2 T C 2: 132,056,709 N636S probably benign Het
Slc25a48 C T 13: 56,463,566 T162I probably damaging Het
Smtn G A 11: 3,524,663 S716F probably damaging Het
Snrnp200 T C 2: 127,226,133 L850P probably damaging Het
Sost G A 11: 101,966,844 P44S probably damaging Het
Sox18 A G 2: 181,670,895 Y148H probably damaging Het
Stk-ps1 A G 17: 36,397,670 noncoding transcript Het
Tas2r104 T A 6: 131,685,444 T101S probably damaging Het
Traf3ip2 C T 10: 39,639,260 P345S possibly damaging Het
Ttn A G 2: 76,752,084 Y22822H probably damaging Het
Vmn2r4 A G 3: 64,409,780 probably null Het
Vmn2r53 T A 7: 12,601,202 H177L probably benign Het
Zbtb20 G T 16: 43,610,676 A517S probably damaging Het
Zfat A T 15: 68,180,282 D554E probably benign Het
Zfp719 C T 7: 43,590,232 H415Y probably damaging Het
Other mutations in Park2
AlleleSourceChrCoordTypePredicted EffectPPH Score
FR4304:Park2 UTSW 17 11854763 missense probably damaging 1.00
FR4340:Park2 UTSW 17 11854763 missense probably damaging 1.00
FR4342:Park2 UTSW 17 11854763 missense probably damaging 1.00
PIT4651001:Park2 UTSW 17 11067243 missense probably damaging 1.00
R0333:Park2 UTSW 17 11067140 missense probably damaging 1.00
R0543:Park2 UTSW 17 11067179 missense probably damaging 1.00
R4460:Park2 UTSW 17 12061646 missense probably damaging 1.00
R4742:Park2 UTSW 17 11237704 critical splice donor site probably null
R4752:Park2 UTSW 17 12004123 missense probably benign
R4911:Park2 UTSW 17 10840472 utr 5 prime probably benign
R5653:Park2 UTSW 17 11237649 missense probably damaging 1.00
R5654:Park2 UTSW 17 11237649 missense probably damaging 1.00
R5655:Park2 UTSW 17 11237649 missense probably damaging 1.00
R6360:Park2 UTSW 17 12004052 missense probably damaging 1.00
R6698:Park2 UTSW 17 11067296 splice site probably null
R7163:Park2 UTSW 17 12061547 missense probably damaging 1.00
R7241:Park2 UTSW 17 11854861 missense possibly damaging 0.63
R7475:Park2 UTSW 17 11434614 missense probably benign
R7630:Park2 UTSW 17 11237568 missense probably benign
X0010:Park2 UTSW 17 11237576 missense probably benign
Predicted Primers PCR Primer
(F):5'- CCCTGAACCGAACTGAGAAG -3'
(R):5'- CAGTTTCAGAGGTCGACTGC -3'

Sequencing Primer
(F):5'- GAAGACAATCCTAGAGTCCTTTGAC -3'
(R):5'- AGTTTCAGAGGTCGACTGCTACTC -3'
Posted On2015-10-21