Incidental Mutation 'R0271:C7'
ID35324
Institutional Source Beutler Lab
Gene Symbol C7
Ensembl Gene ENSMUSG00000079105
Gene Namecomplement component 7
SynonymsLOC383055
MMRRC Submission 038497-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0271 (G1)
Quality Score225
Status Validated
Chromosome15
Chromosomal Location4988762-5063740 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 5015380 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 392 (D392G)
Ref Sequence ENSEMBL: ENSMUSP00000106317 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000110689]
Predicted Effect possibly damaging
Transcript: ENSMUST00000110689
AA Change: D392G

PolyPhen 2 Score 0.807 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000106317
Gene: ENSMUSG00000079105
AA Change: D392G

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
TSP1 30 80 1.95e-7 SMART
LDLa 84 121 6.53e-9 SMART
MACPF 248 450 9.45e-51 SMART
TSP1 503 551 1.62e-4 SMART
CCP 571 626 1.84e-9 SMART
CCP 631 688 2.23e-8 SMART
FIMAC 699 766 1.63e-24 SMART
FIMAC 773 841 4.65e-20 SMART
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 98.5%
  • 3x: 97.4%
  • 10x: 95.2%
  • 20x: 90.6%
Validation Efficiency 100% (65/65)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a serum glycoprotein that forms a membrane attack complex together with complement components C5b, C6, C8, and C9 as part of the terminal complement pathway of the innate immune system. The protein encoded by this gene contains a cholesterol-dependent cytolysin/membrane attack complex/perforin-like (CDC/MACPF) domain and belongs to a large family of structurally related molecules that form pores involved in host immunity and bacterial pathogenesis. This protein initiates membrane attack complex formation by binding the C5b-C6 subcomplex and inserts into the phospholipid bilayer, serving as a membrane anchor. Mutations in this gene are associated with a rare disorder called C7 deficiency. [provided by RefSeq, Nov 2016]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810403A07Rik T C 3: 88,686,329 probably benign Het
4930544D05Rik A G 11: 70,616,648 Q173R possibly damaging Het
Ampd2 C T 3: 108,086,716 probably benign Het
Ankrd17 T C 5: 90,254,799 S1467G possibly damaging Het
Arhgap31 T G 16: 38,602,510 S1065R possibly damaging Het
Arhgef19 G T 4: 141,250,607 M542I probably benign Het
Ccdc138 G A 10: 58,575,823 C671Y probably damaging Het
Cdh8 A G 8: 99,111,715 S498P possibly damaging Het
Cpb2 T A 14: 75,257,709 probably null Het
Cwc22 A C 2: 77,920,858 N389K probably benign Het
Dgkb T A 12: 38,228,026 L550Q probably damaging Het
Dip2c A G 13: 9,615,775 R950G probably damaging Het
Eml6 A G 11: 29,848,949 V437A possibly damaging Het
Fanca T C 8: 123,272,441 probably benign Het
Fgd2 C G 17: 29,367,008 L189V possibly damaging Het
Foxred2 A C 15: 77,943,390 S590A possibly damaging Het
Gm1110 A G 9: 26,920,666 F63S probably damaging Het
Gm14496 A T 2: 181,995,954 M274L probably benign Het
Gm7008 T A 12: 40,223,560 probably benign Het
Gm9922 T A 14: 101,729,553 probably benign Het
Gtf3c3 A T 1: 54,428,812 M222K possibly damaging Het
Hspa1b A G 17: 34,958,832 V59A probably benign Het
Impg1 T C 9: 80,386,879 probably benign Het
Lpcat4 T A 2: 112,243,245 probably null Het
Mipol1 T C 12: 57,460,954 probably benign Het
Mrpl37 C A 4: 107,066,461 R112L possibly damaging Het
Myo18b T C 5: 112,809,685 N1471D possibly damaging Het
Nes G A 3: 87,978,642 E1359K possibly damaging Het
Nipbl A T 15: 8,361,737 V251E possibly damaging Het
Nlrp1b T C 11: 71,161,765 I946V possibly damaging Het
Obscn T G 11: 59,056,742 probably benign Het
Olfr1024 A T 2: 85,904,289 M255K possibly damaging Het
Olfr1239 T A 2: 89,418,158 Y85F probably benign Het
Olfr1491 A T 19: 13,705,135 T103S probably benign Het
Olfr635 T A 7: 103,979,630 I146K possibly damaging Het
Pck2 T C 14: 55,544,584 probably null Het
Pcsk9 A G 4: 106,449,049 probably benign Het
Phyhd1 A T 2: 30,269,822 Q56L probably benign Het
Plxnc1 C T 10: 94,837,918 G1001S probably null Het
Prss52 T C 14: 64,113,678 V304A probably benign Het
Prss55 C T 14: 64,075,607 G276D probably benign Het
Pzp A T 6: 128,519,514 Y252N probably damaging Het
Rad1 T C 15: 10,490,457 probably null Het
Ripply3 A T 16: 94,335,757 E92D possibly damaging Het
Rpp30 T A 19: 36,104,403 D255E probably benign Het
Rsad1 T C 11: 94,548,464 probably benign Het
Serpini2 A G 3: 75,246,578 M358T probably damaging Het
Slc35a1 T A 4: 34,664,125 E331V probably benign Het
Slc38a7 A G 8: 95,845,878 F179L probably damaging Het
Stmn4 C T 14: 66,356,283 Q42* probably null Het
Sytl2 T C 7: 90,403,020 probably benign Het
Tab2 G A 10: 7,919,158 A520V probably benign Het
Tcp10a A G 17: 7,331,156 I162M probably benign Het
Tmprss13 A G 9: 45,333,688 probably benign Het
Tnfrsf14 A G 4: 154,926,597 probably null Het
Tpx2 A G 2: 152,867,367 probably benign Het
Vmn2r105 T A 17: 20,234,703 N57I probably damaging Het
Wars C T 12: 108,875,193 V220I probably benign Het
Washc1 T A 17: 66,116,719 D212E possibly damaging Het
Wdr17 C T 8: 54,693,096 A90T possibly damaging Het
Wdr43 A G 17: 71,626,825 D139G probably benign Het
Zfp235 A T 7: 24,137,131 H34L possibly damaging Het
Zkscan16 G A 4: 58,952,391 V230I probably benign Het
Other mutations in C7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02458:C7 APN 15 5059389 splice site probably benign
IGL02803:C7 APN 15 5049560 missense probably damaging 1.00
R0016:C7 UTSW 15 5046924 missense probably benign 0.01
R0016:C7 UTSW 15 5046924 missense probably benign 0.01
R0360:C7 UTSW 15 4988962 missense probably benign 0.00
R0433:C7 UTSW 15 4988916 missense probably damaging 1.00
R0505:C7 UTSW 15 4994142 splice site probably benign
R1056:C7 UTSW 15 5045778 missense possibly damaging 0.89
R1443:C7 UTSW 15 5059419 missense probably benign 0.01
R1468:C7 UTSW 15 5012149 missense probably damaging 1.00
R1468:C7 UTSW 15 5012149 missense probably damaging 1.00
R1700:C7 UTSW 15 5002792 nonsense probably null
R1774:C7 UTSW 15 5012075 missense probably damaging 0.99
R1801:C7 UTSW 15 5012021 missense possibly damaging 0.61
R1809:C7 UTSW 15 5034339 missense probably damaging 0.99
R1986:C7 UTSW 15 5012012 missense possibly damaging 0.94
R2037:C7 UTSW 15 5034238 nonsense probably null
R2047:C7 UTSW 15 5045661 missense probably damaging 1.00
R2073:C7 UTSW 15 4990428 missense probably benign 0.09
R3972:C7 UTSW 15 5007651 missense possibly damaging 0.77
R4080:C7 UTSW 15 4990464 missense probably benign 0.09
R4200:C7 UTSW 15 4990309 critical splice donor site probably null
R4576:C7 UTSW 15 5002756 missense probably damaging 1.00
R4815:C7 UTSW 15 5059405 missense probably benign 0.16
R4995:C7 UTSW 15 5049592 missense probably damaging 1.00
R5300:C7 UTSW 15 5031950 missense probably damaging 1.00
R5562:C7 UTSW 15 5031915 nonsense probably null
R5708:C7 UTSW 15 5015401 missense possibly damaging 0.90
R5740:C7 UTSW 15 5057040 missense probably benign 0.00
R5873:C7 UTSW 15 5005235 missense probably damaging 1.00
R6222:C7 UTSW 15 5011941 missense possibly damaging 0.89
R6516:C7 UTSW 15 5057081 missense probably damaging 0.98
R6810:C7 UTSW 15 5007654 missense probably damaging 0.98
R7019:C7 UTSW 15 5045682 missense probably benign 0.04
R7199:C7 UTSW 15 4994243 missense probably benign 0.09
R7276:C7 UTSW 15 5011967 missense probably damaging 1.00
R7422:C7 UTSW 15 5012056 missense probably benign 0.13
R7652:C7 UTSW 15 5012105 missense probably damaging 1.00
R7783:C7 UTSW 15 5007710 missense probably benign 0.08
Z1177:C7 UTSW 15 5015375 missense not run
Predicted Primers PCR Primer
(F):5'- TGGGACTCGGAAAATGATAATTGCAGC -3'
(R):5'- GGTTTGCTTTTCTCAAGACGCCATAG -3'

Sequencing Primer
(F):5'- GCAGCCAATTCTGTTTAATCACC -3'
(R):5'- CTCAAGACGCCATAGTTTGATG -3'
Posted On2013-05-09