Incidental Mutation 'R4711:Copa'
ID 353248
Institutional Source Beutler Lab
Gene Symbol Copa
Ensembl Gene ENSMUSG00000026553
Gene Name coatomer protein complex subunit alpha
Synonyms xenin
Accession Numbers

Genbank: NM_009938; MGI: 1334462

Is this an essential gene? Probably essential (E-score: 0.970) question?
Stock # R4711 (G1)
Quality Score 225
Status Not validated
Chromosome 1
Chromosomal Location 172082529-172122330 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to G at 172119988 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Valine at position 1124 (F1124V)
Ref Sequence ENSEMBL: ENSMUSP00000118179 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027833] [ENSMUST00000135192]
AlphaFold Q8CIE6
Predicted Effect probably damaging
Transcript: ENSMUST00000027833
AA Change: F1133V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000027833
Gene: ENSMUSG00000026553
AA Change: F1133V

DomainStartEndE-ValueType
WD40 2 37 2.86e0 SMART
WD40 40 79 1.11e-6 SMART
WD40 82 121 4.76e-6 SMART
WD40 124 163 2.24e-11 SMART
WD40 194 233 2.98e-7 SMART
WD40 238 277 8.42e-7 SMART
WD40 280 318 1.38e1 SMART
Pfam:Coatomer_WDAD 338 776 5.4e-144 PFAM
Pfam:COPI_C 824 1233 1.4e-190 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000122845
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133909
Predicted Effect probably damaging
Transcript: ENSMUST00000135192
AA Change: F1124V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000118179
Gene: ENSMUSG00000026553
AA Change: F1124V

DomainStartEndE-ValueType
WD40 2 37 2.86e0 SMART
WD40 40 79 1.11e-6 SMART
WD40 82 121 4.76e-6 SMART
WD40 124 163 2.24e-11 SMART
WD40 194 233 2.98e-7 SMART
WD40 238 277 8.42e-7 SMART
WD40 280 318 1.38e1 SMART
Pfam:Coatomer_WDAD 338 767 1.1e-148 PFAM
Pfam:COPI_C 815 1224 3.6e-216 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142765
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] In eukaryotic cells, protein transport between the endoplasmic reticulum and Golgi compartments is mediated in part by non-clathrin-coated vesicular coat proteins (COPs). Seven coat proteins have been identified, and they represent subunits of a complex known as coatomer. The subunits are designated alpha-COP, beta-COP, beta-prime-COP, gamma-COP, delta-COP, epsilon-COP, and zeta-COP. The alpha-COP, encoded by COPA, shares high sequence similarity with RET1P, the alpha subunit of the coatomer complex in yeast. Also, the N-terminal 25 amino acids of alpha-COP encode the bioactive peptide, xenin, which stimulates exocrine pancreatic secretion and may act as a gastrointestinal hormone. Alternative splicing results in multiple splice forms encoding distinct isoforms. [provided by RefSeq, Jul 2008]
Allele List at MGI

All alleles(6) : Gene trapped(6)

 

Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Atg14 G A 14: 47,545,841 R346C probably damaging Het
BC005561 T C 5: 104,519,661 V683A probably damaging Het
BC037034 T C 5: 138,262,905 probably benign Het
Bin3 A G 14: 70,128,839 probably null Het
Ccser1 A G 6: 61,311,926 N358D possibly damaging Het
Col20a1 G C 2: 180,992,491 G83A probably damaging Het
Cyp2c66 G A 19: 39,163,399 R186H possibly damaging Het
Dmxl2 G A 9: 54,450,924 T323M probably benign Het
Dner T C 1: 84,383,897 I664V possibly damaging Het
Erp29 A G 5: 121,445,230 I211T possibly damaging Het
Exd1 A G 2: 119,538,751 S128P possibly damaging Het
Gm8394 A G 10: 85,313,803 noncoding transcript Het
Grik4 T A 9: 42,629,093 N264Y probably damaging Het
Gsdma2 T A 11: 98,649,613 S119R probably damaging Het
Hist1h2aa C T 13: 23,934,813 P118S possibly damaging Het
Ift140 T A 17: 25,094,717 probably null Het
Ino80c T C 18: 24,114,165 N59S probably benign Het
Maob T C X: 16,716,423 T400A probably benign Het
Mast4 A G 13: 103,334,119 V25A probably benign Het
Mr1 T C 1: 155,136,590 T193A probably benign Het
Muc5b C A 7: 141,846,033 F414L unknown Het
Nat10 A T 2: 103,748,267 C197* probably null Het
Nt5c1b A G 12: 10,370,093 K11E probably damaging Het
Olfr1104 T C 2: 87,022,026 I173V probably damaging Het
Olfr175-ps1 A T 16: 58,824,706 M1K probably null Het
Pak7 A G 2: 136,087,517 I582T probably damaging Het
Pcdha12 A G 18: 37,020,923 I232V probably benign Het
Pde8b T A 13: 95,030,450 T664S probably benign Het
Pdik1l G C 4: 134,278,990 R214G probably benign Het
Prss37 C T 6: 40,515,447 V157M probably benign Het
Ring1 T C 17: 34,022,359 E261G possibly damaging Het
Sf3a3 C A 4: 124,728,181 D371E probably benign Het
Spag9 T A 11: 94,114,351 probably null Het
Spred1 T A 2: 117,175,385 S209R probably benign Het
Tas2r121 T C 6: 132,700,890 T40A probably benign Het
Tbc1d5 T C 17: 50,935,509 T187A probably damaging Het
Tenm2 C T 11: 36,300,212 V311I probably damaging Het
Tnrc6a A G 7: 123,171,078 D697G probably damaging Het
Ttn G A 2: 76,830,060 A7439V possibly damaging Het
Wdr64 T C 1: 175,799,229 I838T probably damaging Het
Wdr7 A G 18: 63,728,465 T183A probably benign Het
Other mutations in Copa
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00848:Copa APN 1 172110688 missense possibly damaging 0.87
IGL01360:Copa APN 1 172087588 splice site probably null
IGL01434:Copa APN 1 172119561 missense probably benign 0.00
IGL01744:Copa APN 1 172113189 missense probably benign 0.01
IGL01837:Copa APN 1 172118852 missense probably benign 0.01
IGL01988:Copa APN 1 172118264 missense probably benign 0.09
IGL02059:Copa APN 1 172099753 missense probably damaging 0.96
IGL02123:Copa APN 1 172112128 missense probably damaging 1.00
IGL02731:Copa APN 1 172102218 missense possibly damaging 0.77
IGL03114:Copa APN 1 172119268 nonsense probably null
P0027:Copa UTSW 1 172111948 missense possibly damaging 0.87
PIT4434001:Copa UTSW 1 172106175 missense probably benign 0.00
R0233:Copa UTSW 1 172087667 critical splice donor site probably null
R0465:Copa UTSW 1 172118305 missense probably damaging 1.00
R0547:Copa UTSW 1 172121687 splice site probably benign
R0568:Copa UTSW 1 172112137 missense possibly damaging 0.91
R0628:Copa UTSW 1 172091025 splice site probably benign
R1328:Copa UTSW 1 172121691 splice site probably benign
R1494:Copa UTSW 1 172104127 missense probably benign 0.27
R1728:Copa UTSW 1 172111987 missense probably benign
R1758:Copa UTSW 1 172104144 missense probably damaging 1.00
R1784:Copa UTSW 1 172111987 missense probably benign
R1942:Copa UTSW 1 172111888 missense probably damaging 1.00
R2054:Copa UTSW 1 172118957 nonsense probably null
R2299:Copa UTSW 1 172121725 missense probably benign 0.10
R2518:Copa UTSW 1 172119901 missense probably benign
R2680:Copa UTSW 1 172121404 nonsense probably null
R3080:Copa UTSW 1 172113149 missense probably damaging 1.00
R3160:Copa UTSW 1 172091233 missense probably damaging 1.00
R3161:Copa UTSW 1 172091233 missense probably damaging 1.00
R3162:Copa UTSW 1 172091233 missense probably damaging 1.00
R3162:Copa UTSW 1 172091233 missense probably damaging 1.00
R3973:Copa UTSW 1 172121245 missense probably benign 0.00
R3975:Copa UTSW 1 172121245 missense probably benign 0.00
R4031:Copa UTSW 1 172108375 missense probably damaging 1.00
R4155:Copa UTSW 1 172101425 missense probably damaging 1.00
R4227:Copa UTSW 1 172118115 intron probably benign
R4244:Copa UTSW 1 172110718 missense probably benign 0.00
R4254:Copa UTSW 1 172102244 missense probably damaging 1.00
R4291:Copa UTSW 1 172092397 intron probably benign
R4323:Copa UTSW 1 172119264 missense probably damaging 1.00
R4402:Copa UTSW 1 172102224 missense probably damaging 1.00
R4721:Copa UTSW 1 172104274 splice site probably benign
R4773:Copa UTSW 1 172105220 missense probably damaging 1.00
R4794:Copa UTSW 1 172119321 missense probably damaging 1.00
R4887:Copa UTSW 1 172092276 missense probably benign 0.39
R4953:Copa UTSW 1 172082886 unclassified probably benign
R5139:Copa UTSW 1 172121329 missense probably damaging 0.99
R5152:Copa UTSW 1 172118061 missense probably benign 0.34
R5297:Copa UTSW 1 172113108 missense probably damaging 1.00
R5586:Copa UTSW 1 172105222 missense probably damaging 1.00
R5698:Copa UTSW 1 172118944 nonsense probably null
R6283:Copa UTSW 1 172118848 missense possibly damaging 0.79
R6921:Copa UTSW 1 172111924 missense possibly damaging 0.63
R6934:Copa UTSW 1 172110686 missense possibly damaging 0.64
R7009:Copa UTSW 1 172091000 missense probably damaging 0.96
R7194:Copa UTSW 1 172119944 missense probably damaging 0.99
R7348:Copa UTSW 1 172102223 missense possibly damaging 0.96
R7710:Copa UTSW 1 172109844 missense possibly damaging 0.50
R7745:Copa UTSW 1 172111942 missense probably damaging 1.00
R7893:Copa UTSW 1 172119565 nonsense probably null
R8168:Copa UTSW 1 172099672 missense probably damaging 1.00
R8273:Copa UTSW 1 172118979 critical splice donor site probably null
R8704:Copa UTSW 1 172104126 missense probably benign 0.01
R8754:Copa UTSW 1 172108359 missense probably damaging 1.00
R8757:Copa UTSW 1 172119514 missense probably benign 0.04
R8759:Copa UTSW 1 172119514 missense probably benign 0.04
R8885:Copa UTSW 1 172097745 missense probably damaging 1.00
R8891:Copa UTSW 1 172119251 missense probably damaging 1.00
R8927:Copa UTSW 1 172104170 missense probably null 0.03
R8928:Copa UTSW 1 172104170 missense probably null 0.03
R8956:Copa UTSW 1 172109913 missense possibly damaging 0.65
R9063:Copa UTSW 1 172116962 missense probably benign 0.00
R9295:Copa UTSW 1 172112256 missense probably damaging 0.99
R9364:Copa UTSW 1 172117264 missense probably benign 0.00
R9437:Copa UTSW 1 172104145 missense possibly damaging 0.93
T0722:Copa UTSW 1 172111948 missense possibly damaging 0.87
Z1177:Copa UTSW 1 172106123 frame shift probably null
Predicted Primers PCR Primer
(F):5'- CGAGGTGTTCCATTTCTCCG -3'
(R):5'- AGGGCAGAACACTCTATTAGC -3'

Sequencing Primer
(F):5'- GTTTAAGAGGAAGAGCTAATCTGTC -3'
(R):5'- GGCAGAACACTCTATTAGCTTTCTTG -3'
Posted On 2015-10-21