Incidental Mutation 'R4711:Tas2r121'
ID353267
Institutional Source Beutler Lab
Gene Symbol Tas2r121
Ensembl Gene ENSMUSG00000071150
Gene Nametaste receptor, type 2, member 121
SynonymsTas2r21, T2R21, mGR21, mT2r48
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.068) question?
Stock #R4711 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location132700090-132701007 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 132700890 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 40 (T40A)
Ref Sequence ENSEMBL: ENSMUSP00000093044 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000095395]
Predicted Effect probably benign
Transcript: ENSMUST00000095395
AA Change: T40A

PolyPhen 2 Score 0.283 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000093044
Gene: ENSMUSG00000071150
AA Change: T40A

DomainStartEndE-ValueType
Pfam:TAS2R 1 300 4.5e-108 PFAM
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene product belongs to the family of candidate taste receptors that are members of the G-protein-coupled receptor superfamily. These proteins are specifically expressed in the taste receptor cells of the tongue and palate epithelia. They are organized in the genome in clusters and are genetically linked to loci that influence bitter perception in mice and humans. In functional expression studies, they respond to bitter tastants. This gene maps to the taste receptor gene cluster on chromosome 12p13. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Atg14 G A 14: 47,545,841 R346C probably damaging Het
BC005561 T C 5: 104,519,661 V683A probably damaging Het
BC037034 T C 5: 138,262,905 probably benign Het
Bin3 A G 14: 70,128,839 probably null Het
Ccser1 A G 6: 61,311,926 N358D possibly damaging Het
Col20a1 G C 2: 180,992,491 G83A probably damaging Het
Copa T G 1: 172,119,988 F1124V probably damaging Het
Cyp2c66 G A 19: 39,163,399 R186H possibly damaging Het
Dmxl2 G A 9: 54,450,924 T323M probably benign Het
Dner T C 1: 84,383,897 I664V possibly damaging Het
Erp29 A G 5: 121,445,230 I211T possibly damaging Het
Exd1 A G 2: 119,538,751 S128P possibly damaging Het
Gm8394 A G 10: 85,313,803 noncoding transcript Het
Grik4 T A 9: 42,629,093 N264Y probably damaging Het
Gsdma2 T A 11: 98,649,613 S119R probably damaging Het
Hist1h2aa C T 13: 23,934,813 P118S possibly damaging Het
Ift140 T A 17: 25,094,717 probably null Het
Ino80c T C 18: 24,114,165 N59S probably benign Het
Maob T C X: 16,716,423 T400A probably benign Het
Mast4 A G 13: 103,334,119 V25A probably benign Het
Mr1 T C 1: 155,136,590 T193A probably benign Het
Muc5b C A 7: 141,846,033 F414L unknown Het
Nat10 A T 2: 103,748,267 C197* probably null Het
Nt5c1b A G 12: 10,370,093 K11E probably damaging Het
Olfr1104 T C 2: 87,022,026 I173V probably damaging Het
Olfr175-ps1 A T 16: 58,824,706 M1K probably null Het
Pak7 A G 2: 136,087,517 I582T probably damaging Het
Pcdha12 A G 18: 37,020,923 I232V probably benign Het
Pde8b T A 13: 95,030,450 T664S probably benign Het
Pdik1l G C 4: 134,278,990 R214G probably benign Het
Prss37 C T 6: 40,515,447 V157M probably benign Het
Ring1 T C 17: 34,022,359 E261G possibly damaging Het
Sf3a3 C A 4: 124,728,181 D371E probably benign Het
Spag9 T A 11: 94,114,351 probably null Het
Spred1 T A 2: 117,175,385 S209R probably benign Het
Tbc1d5 T C 17: 50,935,509 T187A probably damaging Het
Tenm2 C T 11: 36,300,212 V311I probably damaging Het
Tnrc6a A G 7: 123,171,078 D697G probably damaging Het
Ttn G A 2: 76,830,060 A7439V possibly damaging Het
Wdr64 T C 1: 175,799,229 I838T probably damaging Het
Wdr7 A G 18: 63,728,465 T183A probably benign Het
Other mutations in Tas2r121
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00559:Tas2r121 APN 6 132700521 missense probably benign 0.28
IGL01868:Tas2r121 APN 6 132700272 missense probably benign 0.00
IGL02182:Tas2r121 APN 6 132700170 missense probably damaging 0.99
IGL02728:Tas2r121 APN 6 132700517 missense probably damaging 1.00
R0833:Tas2r121 UTSW 6 132700362 missense probably damaging 1.00
R0836:Tas2r121 UTSW 6 132700362 missense probably damaging 1.00
R1181:Tas2r121 UTSW 6 132700169 missense probably damaging 1.00
R1424:Tas2r121 UTSW 6 132700682 missense probably damaging 1.00
R1583:Tas2r121 UTSW 6 132700230 nonsense probably null
R2179:Tas2r121 UTSW 6 132700868 missense probably damaging 1.00
R5274:Tas2r121 UTSW 6 132700848 missense probably damaging 1.00
R5308:Tas2r121 UTSW 6 132700517 missense possibly damaging 0.84
R5663:Tas2r121 UTSW 6 132700557 missense probably benign 0.10
R5668:Tas2r121 UTSW 6 132700793 missense possibly damaging 0.95
R5885:Tas2r121 UTSW 6 132700291 missense probably damaging 1.00
R6395:Tas2r121 UTSW 6 132700532 missense probably benign 0.23
R7552:Tas2r121 UTSW 6 132700542 missense probably benign 0.17
R8094:Tas2r121 UTSW 6 132700809 missense probably benign
Predicted Primers PCR Primer
(F):5'- TGGAGAAACTGGCTATTTTGAGC -3'
(R):5'- TACAGGGACATTTCACCTTGCC -3'

Sequencing Primer
(F):5'- TGCTGAGAATAGTGGCAAGCC -3'
(R):5'- GGGACATTTCACCTTGCCAAATGAG -3'
Posted On2015-10-21