Incidental Mutation 'R4711:Gm8394'
ID353275
Institutional Source Beutler Lab
Gene Symbol Gm8394
Ensembl Gene ENSMUSG00000050490
Gene Namepredicted gene 8394
Synonyms
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.864) question?
Stock #R4711 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location85313488-85314439 bp(+) (GRCm38)
Type of Mutationexon
DNA Base Change (assembly) A to G at 85313803 bp
ZygosityHeterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s):
Predicted Effect noncoding transcript
Transcript: ENSMUST00000079684
SMART Domains Protein: ENSMUSP00000078625
Gene: ENSMUSG00000050490

DomainStartEndE-ValueType
Proteasome_A_N 8 30 6.32e-8 SMART
Pfam:Proteasome 31 220 5.6e-57 PFAM
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Atg14 G A 14: 47,545,841 R346C probably damaging Het
BC005561 T C 5: 104,519,661 V683A probably damaging Het
BC037034 T C 5: 138,262,905 probably benign Het
Bin3 A G 14: 70,128,839 probably null Het
Ccser1 A G 6: 61,311,926 N358D possibly damaging Het
Col20a1 G C 2: 180,992,491 G83A probably damaging Het
Copa T G 1: 172,119,988 F1124V probably damaging Het
Cyp2c66 G A 19: 39,163,399 R186H possibly damaging Het
Dmxl2 G A 9: 54,450,924 T323M probably benign Het
Dner T C 1: 84,383,897 I664V possibly damaging Het
Erp29 A G 5: 121,445,230 I211T possibly damaging Het
Exd1 A G 2: 119,538,751 S128P possibly damaging Het
Grik4 T A 9: 42,629,093 N264Y probably damaging Het
Gsdma2 T A 11: 98,649,613 S119R probably damaging Het
Hist1h2aa C T 13: 23,934,813 P118S possibly damaging Het
Ift140 T A 17: 25,094,717 probably null Het
Ino80c T C 18: 24,114,165 N59S probably benign Het
Maob T C X: 16,716,423 T400A probably benign Het
Mast4 A G 13: 103,334,119 V25A probably benign Het
Mr1 T C 1: 155,136,590 T193A probably benign Het
Muc5b C A 7: 141,846,033 F414L unknown Het
Nat10 A T 2: 103,748,267 C197* probably null Het
Nt5c1b A G 12: 10,370,093 K11E probably damaging Het
Olfr1104 T C 2: 87,022,026 I173V probably damaging Het
Olfr175-ps1 A T 16: 58,824,706 M1K probably null Het
Pak7 A G 2: 136,087,517 I582T probably damaging Het
Pcdha12 A G 18: 37,020,923 I232V probably benign Het
Pde8b T A 13: 95,030,450 T664S probably benign Het
Pdik1l G C 4: 134,278,990 R214G probably benign Het
Prss37 C T 6: 40,515,447 V157M probably benign Het
Ring1 T C 17: 34,022,359 E261G possibly damaging Het
Sf3a3 C A 4: 124,728,181 D371E probably benign Het
Spag9 T A 11: 94,114,351 probably null Het
Spred1 T A 2: 117,175,385 S209R probably benign Het
Tas2r121 T C 6: 132,700,890 T40A probably benign Het
Tbc1d5 T C 17: 50,935,509 T187A probably damaging Het
Tenm2 C T 11: 36,300,212 V311I probably damaging Het
Tnrc6a A G 7: 123,171,078 D697G probably damaging Het
Ttn G A 2: 76,830,060 A7439V possibly damaging Het
Wdr64 T C 1: 175,799,229 I838T probably damaging Het
Wdr7 A G 18: 63,728,465 T183A probably benign Het
Other mutations in Gm8394
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01336:Gm8394 APN 10 85314164 exon noncoding transcript
IGL01467:Gm8394 APN 10 85314122 exon noncoding transcript
IGL02638:Gm8394 APN 10 85313834 exon noncoding transcript
IGL03253:Gm8394 APN 10 85313692 exon noncoding transcript
R1929:Gm8394 UTSW 10 85313731 exon noncoding transcript
R2271:Gm8394 UTSW 10 85313731 exon noncoding transcript
R2893:Gm8394 UTSW 10 85313984 exon noncoding transcript
R4689:Gm8394 UTSW 10 85314201 exon noncoding transcript
R5537:Gm8394 UTSW 10 85314049 exon noncoding transcript
R5934:Gm8394 UTSW 10 85314281 exon noncoding transcript
T0722:Gm8394 UTSW 10 85313593 exon noncoding transcript
Predicted Primers PCR Primer
(F):5'- TTTCAAGTGGAATACGCCATTGAG -3'
(R):5'- GAAACAGTTGGGGTCCTTTCC -3'

Sequencing Primer
(F):5'- TGTCTAGCTGTGGAGAAG -3'
(R):5'- TGCTACTCCAAAGGGACGAGAC -3'
Posted On2015-10-21