Incidental Mutation 'R4711:Atg14'
ID353282
Institutional Source Beutler Lab
Gene Symbol Atg14
Ensembl Gene ENSMUSG00000037526
Gene Nameautophagy related 14
SynonymsBarkor, D14Ertd436e, D14Ertd114e
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.883) question?
Stock #R4711 (G1)
Quality Score225
Status Not validated
Chromosome14
Chromosomal Location47540893-47570649 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 47545841 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Cysteine at position 346 (R346C)
Ref Sequence ENSEMBL: ENSMUSP00000153718 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042988] [ENSMUST00000226299]
Predicted Effect probably damaging
Transcript: ENSMUST00000042988
AA Change: R346C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000039047
Gene: ENSMUSG00000037526
AA Change: R346C

DomainStartEndE-ValueType
Pfam:Atg14 43 393 1.1e-79 PFAM
low complexity region 447 464 N/A INTRINSIC
low complexity region 465 480 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000226299
AA Change: R346C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000228568
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.7%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a conditional allele following delivery of a Tat-cre exhibit increased mucin accumulation in colonic epithelial spheroids. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
BC005561 T C 5: 104,519,661 V683A probably damaging Het
BC037034 T C 5: 138,262,905 probably benign Het
Bin3 A G 14: 70,128,839 probably null Het
Ccser1 A G 6: 61,311,926 N358D possibly damaging Het
Col20a1 G C 2: 180,992,491 G83A probably damaging Het
Copa T G 1: 172,119,988 F1124V probably damaging Het
Cyp2c66 G A 19: 39,163,399 R186H possibly damaging Het
Dmxl2 G A 9: 54,450,924 T323M probably benign Het
Dner T C 1: 84,383,897 I664V possibly damaging Het
Erp29 A G 5: 121,445,230 I211T possibly damaging Het
Exd1 A G 2: 119,538,751 S128P possibly damaging Het
Gm8394 A G 10: 85,313,803 noncoding transcript Het
Grik4 T A 9: 42,629,093 N264Y probably damaging Het
Gsdma2 T A 11: 98,649,613 S119R probably damaging Het
Hist1h2aa C T 13: 23,934,813 P118S possibly damaging Het
Ift140 T A 17: 25,094,717 probably null Het
Ino80c T C 18: 24,114,165 N59S probably benign Het
Maob T C X: 16,716,423 T400A probably benign Het
Mast4 A G 13: 103,334,119 V25A probably benign Het
Mr1 T C 1: 155,136,590 T193A probably benign Het
Muc5b C A 7: 141,846,033 F414L unknown Het
Nat10 A T 2: 103,748,267 C197* probably null Het
Nt5c1b A G 12: 10,370,093 K11E probably damaging Het
Olfr1104 T C 2: 87,022,026 I173V probably damaging Het
Olfr175-ps1 A T 16: 58,824,706 M1K probably null Het
Pak7 A G 2: 136,087,517 I582T probably damaging Het
Pcdha12 A G 18: 37,020,923 I232V probably benign Het
Pde8b T A 13: 95,030,450 T664S probably benign Het
Pdik1l G C 4: 134,278,990 R214G probably benign Het
Prss37 C T 6: 40,515,447 V157M probably benign Het
Ring1 T C 17: 34,022,359 E261G possibly damaging Het
Sf3a3 C A 4: 124,728,181 D371E probably benign Het
Spag9 T A 11: 94,114,351 probably null Het
Spred1 T A 2: 117,175,385 S209R probably benign Het
Tas2r121 T C 6: 132,700,890 T40A probably benign Het
Tbc1d5 T C 17: 50,935,509 T187A probably damaging Het
Tenm2 C T 11: 36,300,212 V311I probably damaging Het
Tnrc6a A G 7: 123,171,078 D697G probably damaging Het
Ttn G A 2: 76,830,060 A7439V possibly damaging Het
Wdr64 T C 1: 175,799,229 I838T probably damaging Het
Wdr7 A G 18: 63,728,465 T183A probably benign Het
Other mutations in Atg14
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02088:Atg14 APN 14 47542859 missense probably benign 0.00
IGL02513:Atg14 APN 14 47548994 missense probably benign 0.03
IGL02513:Atg14 APN 14 47545624 splice site probably benign
PIT4243001:Atg14 UTSW 14 47554574 missense possibly damaging 0.77
R1463:Atg14 UTSW 14 47548994 missense probably benign 0.03
R1479:Atg14 UTSW 14 47547239 critical splice donor site probably null
R1499:Atg14 UTSW 14 47560645 missense probably benign
R1781:Atg14 UTSW 14 47549150 critical splice acceptor site probably null
R1974:Atg14 UTSW 14 47545841 missense probably damaging 1.00
R2089:Atg14 UTSW 14 47542895 missense probably damaging 1.00
R2091:Atg14 UTSW 14 47542895 missense probably damaging 1.00
R2091:Atg14 UTSW 14 47542895 missense probably damaging 1.00
R2113:Atg14 UTSW 14 47551324 missense probably damaging 1.00
R4231:Atg14 UTSW 14 47551345 missense probably benign 0.00
R4232:Atg14 UTSW 14 47551345 missense probably benign 0.00
R4233:Atg14 UTSW 14 47551345 missense probably benign 0.00
R4234:Atg14 UTSW 14 47551345 missense probably benign 0.00
R4236:Atg14 UTSW 14 47551345 missense probably benign 0.00
R4360:Atg14 UTSW 14 47568370 missense probably benign 0.00
R4883:Atg14 UTSW 14 47551314 missense probably damaging 1.00
R5025:Atg14 UTSW 14 47545816 missense probably damaging 1.00
R5235:Atg14 UTSW 14 47568199 missense probably damaging 0.98
R5250:Atg14 UTSW 14 47568199 missense probably damaging 0.98
R5297:Atg14 UTSW 14 47568199 missense probably damaging 0.98
R5301:Atg14 UTSW 14 47568199 missense probably damaging 0.98
R5338:Atg14 UTSW 14 47568199 missense probably damaging 0.98
R5450:Atg14 UTSW 14 47551464 missense probably benign
R5475:Atg14 UTSW 14 47568336 missense possibly damaging 0.83
R5799:Atg14 UTSW 14 47547295 missense possibly damaging 0.63
R6489:Atg14 UTSW 14 47549023 missense probably damaging 0.97
R7589:Atg14 UTSW 14 47543090 missense probably benign 0.00
R7908:Atg14 UTSW 14 47568593 unclassified probably benign
Z1088:Atg14 UTSW 14 47568292 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTGCATCAGGTTCCTGAGTG -3'
(R):5'- GCTCAGTCACCTAGGTACTTGC -3'

Sequencing Primer
(F):5'- CATCAGGTTCCTGAGTGTGTGC -3'
(R):5'- CTGTCTCAGGCAGTCTACTAAGGAG -3'
Posted On2015-10-21