Incidental Mutation 'R4711:Ift140'
ID353284
Institutional Source Beutler Lab
Gene Symbol Ift140
Ensembl Gene ENSMUSG00000024169
Gene Nameintraflagellar transport 140
SynonymsTce5, Wdtc2
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4711 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location25016091-25099495 bp(+) (GRCm38)
Type of Mutationsplice site (4853 bp from exon)
DNA Base Change (assembly) T to A at 25094717 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000110835 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024983] [ENSMUST00000024987] [ENSMUST00000115181] [ENSMUST00000137386]
Predicted Effect probably damaging
Transcript: ENSMUST00000024983
AA Change: I1374N

PolyPhen 2 Score 0.978 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000024983
Gene: ENSMUSG00000024169
AA Change: I1374N

DomainStartEndE-ValueType
WD40 55 89 6.14e1 SMART
WD40 91 131 1.49e0 SMART
Blast:WD40 252 304 3e-15 BLAST
WD40 308 352 2.76e0 SMART
Blast:WD40 364 405 8e-17 BLAST
Blast:WD40 510 547 6e-13 BLAST
Blast:WD40 560 603 3e-7 BLAST
Blast:TPR 863 896 9e-13 BLAST
Blast:TPR 1011 1044 1e-13 BLAST
Blast:TPR 1377 1410 8e-13 BLAST
Predicted Effect probably null
Transcript: ENSMUST00000024987
SMART Domains Protein: ENSMUSP00000024987
Gene: ENSMUSG00000024170

DomainStartEndE-ValueType
Pfam:Telomere_reg-2 513 621 3.8e-38 PFAM
low complexity region 771 782 N/A INTRINSIC
low complexity region 816 837 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000115181
SMART Domains Protein: ENSMUSP00000110835
Gene: ENSMUSG00000024170

DomainStartEndE-ValueType
Pfam:Telomere_reg-2 513 621 3.8e-38 PFAM
low complexity region 771 782 N/A INTRINSIC
low complexity region 816 837 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000137386
SMART Domains Protein: ENSMUSP00000116163
Gene: ENSMUSG00000024169

DomainStartEndE-ValueType
WD40 55 89 6.14e1 SMART
WD40 91 131 1.49e0 SMART
Blast:WD40 252 304 3e-15 BLAST
WD40 308 352 2.76e0 SMART
Blast:WD40 364 405 1e-16 BLAST
Blast:WD40 510 547 5e-13 BLAST
Blast:WD40 560 603 3e-7 BLAST
Blast:TPR 863 896 8e-13 BLAST
Blast:TPR 1011 1044 9e-14 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139300
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142000
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152460
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153895
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155607
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155632
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one of the subunits of the intraflagellar transport (IFT) complex A. Intraflagellar transport is involved in the genesis, resorption and signaling of primary cilia. The primary cilium is a microtubule-based sensory organelle at the surface of most quiescent mammalian cells, that receives signals from its environment, such as the flow of fluid, light or odors, and transduces those signals to the nucleus. Loss of the corresponding protein in mouse results in renal cystic disease. [provided by RefSeq, Jun 2012]
PHENOTYPE: Mice homozygous for a reporter knock-out allele die at mid-gestation. Mice homozygous for an ENU-induced mutation exhibit cardiovascular defects and situs abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Atg14 G A 14: 47,545,841 R346C probably damaging Het
BC005561 T C 5: 104,519,661 V683A probably damaging Het
BC037034 T C 5: 138,262,905 probably benign Het
Bin3 A G 14: 70,128,839 probably null Het
Ccser1 A G 6: 61,311,926 N358D possibly damaging Het
Col20a1 G C 2: 180,992,491 G83A probably damaging Het
Copa T G 1: 172,119,988 F1124V probably damaging Het
Cyp2c66 G A 19: 39,163,399 R186H possibly damaging Het
Dmxl2 G A 9: 54,450,924 T323M probably benign Het
Dner T C 1: 84,383,897 I664V possibly damaging Het
Erp29 A G 5: 121,445,230 I211T possibly damaging Het
Exd1 A G 2: 119,538,751 S128P possibly damaging Het
Gm8394 A G 10: 85,313,803 noncoding transcript Het
Grik4 T A 9: 42,629,093 N264Y probably damaging Het
Gsdma2 T A 11: 98,649,613 S119R probably damaging Het
Hist1h2aa C T 13: 23,934,813 P118S possibly damaging Het
Ino80c T C 18: 24,114,165 N59S probably benign Het
Maob T C X: 16,716,423 T400A probably benign Het
Mast4 A G 13: 103,334,119 V25A probably benign Het
Mr1 T C 1: 155,136,590 T193A probably benign Het
Muc5b C A 7: 141,846,033 F414L unknown Het
Nat10 A T 2: 103,748,267 C197* probably null Het
Nt5c1b A G 12: 10,370,093 K11E probably damaging Het
Olfr1104 T C 2: 87,022,026 I173V probably damaging Het
Olfr175-ps1 A T 16: 58,824,706 M1K probably null Het
Pak7 A G 2: 136,087,517 I582T probably damaging Het
Pcdha12 A G 18: 37,020,923 I232V probably benign Het
Pde8b T A 13: 95,030,450 T664S probably benign Het
Pdik1l G C 4: 134,278,990 R214G probably benign Het
Prss37 C T 6: 40,515,447 V157M probably benign Het
Ring1 T C 17: 34,022,359 E261G possibly damaging Het
Sf3a3 C A 4: 124,728,181 D371E probably benign Het
Spag9 T A 11: 94,114,351 probably null Het
Spred1 T A 2: 117,175,385 S209R probably benign Het
Tas2r121 T C 6: 132,700,890 T40A probably benign Het
Tbc1d5 T C 17: 50,935,509 T187A probably damaging Het
Tenm2 C T 11: 36,300,212 V311I probably damaging Het
Tnrc6a A G 7: 123,171,078 D697G probably damaging Het
Ttn G A 2: 76,830,060 A7439V possibly damaging Het
Wdr64 T C 1: 175,799,229 I838T probably damaging Het
Wdr7 A G 18: 63,728,465 T183A probably benign Het
Other mutations in Ift140
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00753:Ift140 APN 17 25055644 missense probably damaging 1.00
IGL00966:Ift140 APN 17 25018802 missense probably damaging 1.00
IGL01082:Ift140 APN 17 25048455 missense possibly damaging 0.89
IGL01394:Ift140 APN 17 25094702 missense probably benign 0.02
IGL01816:Ift140 APN 17 25087025 splice site probably null
IGL01994:Ift140 APN 17 25048443 missense probably damaging 1.00
IGL02102:Ift140 APN 17 25033130 missense probably benign 0.03
IGL02207:Ift140 APN 17 25055598 missense probably benign
IGL02493:Ift140 APN 17 25087924 nonsense probably null
IGL02735:Ift140 APN 17 25034035 splice site probably benign
IGL02902:Ift140 APN 17 25090762 missense probably damaging 1.00
IGL03037:Ift140 APN 17 25092394 missense probably benign 0.02
IGL03122:Ift140 APN 17 25086910 missense probably damaging 1.00
IGL03206:Ift140 APN 17 25092826 missense probably damaging 0.98
IGL03271:Ift140 APN 17 25087906 missense probably damaging 1.00
IGL03358:Ift140 APN 17 25087984 missense probably damaging 1.00
PIT4515001:Ift140 UTSW 17 25086860 missense probably damaging 0.98
R0100:Ift140 UTSW 17 25090954 nonsense probably null
R0100:Ift140 UTSW 17 25090954 nonsense probably null
R0197:Ift140 UTSW 17 25090933 missense probably benign 0.09
R0238:Ift140 UTSW 17 25045523 nonsense probably null
R0238:Ift140 UTSW 17 25045523 nonsense probably null
R0239:Ift140 UTSW 17 25045523 nonsense probably null
R0239:Ift140 UTSW 17 25045523 nonsense probably null
R0355:Ift140 UTSW 17 25048435 nonsense probably null
R0399:Ift140 UTSW 17 25050340 missense possibly damaging 0.77
R0574:Ift140 UTSW 17 25051760 splice site probably null
R0610:Ift140 UTSW 17 25035803 missense probably benign 0.06
R0701:Ift140 UTSW 17 25090933 missense probably benign 0.09
R0883:Ift140 UTSW 17 25090933 missense probably benign 0.09
R0900:Ift140 UTSW 17 25035812 missense probably benign 0.22
R1167:Ift140 UTSW 17 25035745 missense probably benign 0.01
R1295:Ift140 UTSW 17 25088933 critical splice donor site probably null
R1588:Ift140 UTSW 17 25087985 missense probably damaging 1.00
R1619:Ift140 UTSW 17 25088865 missense probably damaging 1.00
R1637:Ift140 UTSW 17 25025634 missense probably benign 0.40
R1854:Ift140 UTSW 17 25035839 missense probably benign 0.05
R2397:Ift140 UTSW 17 25020736 missense probably damaging 1.00
R2510:Ift140 UTSW 17 25036308 missense probably benign 0.02
R2918:Ift140 UTSW 17 25035831 missense possibly damaging 0.66
R3433:Ift140 UTSW 17 25036308 missense probably benign 0.02
R3878:Ift140 UTSW 17 25028944 missense probably benign 0.25
R4559:Ift140 UTSW 17 25090767 missense probably damaging 0.97
R4670:Ift140 UTSW 17 25098961 unclassified probably benign
R4934:Ift140 UTSW 17 25048488 missense probably benign
R4949:Ift140 UTSW 17 25094665 missense probably benign 0.06
R4982:Ift140 UTSW 17 25036994 missense probably damaging 0.99
R5099:Ift140 UTSW 17 25090700 missense probably damaging 1.00
R5223:Ift140 UTSW 17 25035812 missense probably benign 0.22
R5268:Ift140 UTSW 17 25020627 missense possibly damaging 0.48
R5423:Ift140 UTSW 17 25033085 missense probably damaging 0.96
R5480:Ift140 UTSW 17 25020576 missense probably damaging 1.00
R5655:Ift140 UTSW 17 25045064 missense probably damaging 1.00
R5756:Ift140 UTSW 17 25028813 missense possibly damaging 0.62
R5837:Ift140 UTSW 17 25089540 missense probably damaging 1.00
R5894:Ift140 UTSW 17 25033919 missense possibly damaging 0.92
R5907:Ift140 UTSW 17 25092371 missense probably benign 0.02
R5966:Ift140 UTSW 17 25094761 nonsense probably null
R6000:Ift140 UTSW 17 25036960 missense probably benign 0.00
R6046:Ift140 UTSW 17 25055589 missense probably benign 0.00
R6050:Ift140 UTSW 17 25091005 missense probably damaging 1.00
R6103:Ift140 UTSW 17 25093126 missense probably damaging 1.00
R6239:Ift140 UTSW 17 25028972 missense probably benign 0.26
R6287:Ift140 UTSW 17 25050434 missense probably benign
R6539:Ift140 UTSW 17 25094669 missense possibly damaging 0.87
R6656:Ift140 UTSW 17 25032173 missense probably damaging 0.96
R6723:Ift140 UTSW 17 25033116 missense probably benign 0.08
R6749:Ift140 UTSW 17 25098916 missense probably damaging 0.99
R6892:Ift140 UTSW 17 25020546 missense possibly damaging 0.95
R7151:Ift140 UTSW 17 25055725 missense probably damaging 1.00
R7235:Ift140 UTSW 17 25020645 missense possibly damaging 0.88
R7424:Ift140 UTSW 17 25037036 missense possibly damaging 0.81
R7552:Ift140 UTSW 17 25033115 missense probably benign 0.02
R7560:Ift140 UTSW 17 25092341 missense probably benign 0.28
R7660:Ift140 UTSW 17 25051824 missense probably damaging 1.00
R8105:Ift140 UTSW 17 25036975 missense probably benign 0.01
R8415:Ift140 UTSW 17 25092915 missense probably damaging 0.99
R8437:Ift140 UTSW 17 25094677 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- AGCCACTCCTGCAGGACAG -3'
(R):5'- GAGCAAAGTGAATGTGCCGGT -3'

Sequencing Primer
(F):5'- GGTGCCCACAACAGCTTCTG -3'
(R):5'- CCCCTCAGTGATGGAATTGTAAG -3'
Posted On2015-10-21