Mutagenetix > Incidental Mutations

Incidental Mutation 'R0271:Ripply3'

35329

Institutional Source

Beutler Lab

Gene Symbol

Ripply3

Ensembl Gene

ENSMUSG00000022941

Gene Name

ripply transcriptional repressor 3

Synonyms

Dscr6

MMRRC Submission

038497-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.136) question?

Stock #

R0271 (G1)

Quality Score

130

Status

Validated

Chromosome

Chromosomal Location

94328420-94336935 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 94335757 bp

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Aspartic acid at position 92 (E92D)

Ref Sequence

ENSEMBL: ENSMUSP00000023660 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000023660]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000023660
AA Change: E92D

PolyPhen 2 Score 0.820 (Sensitivity: 0.84; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000023660
Gene: ENSMUSG00000022941
AA Change: E92D

Domain	Start	End	E-Value	Type
Pfam:Ripply	39	127	6.2e-35	PFAM

Meta Mutation Damage Score

0.0896

Coding Region Coverage

1x: 98.5%
3x: 97.4%
10x: 95.2%
20x: 90.6%

Validation Efficiency

100% (65/65)

MGI Phenotype

PHENOTYPE: Homozygotes for a reporter allele show complete neonatal lethality, abnormal development of the pharyngeal apparatus and its derivatives including ectopic formation of the thymus and the parathyroid gland, and cardiovascular defects such as deletion of the aortic arch and misshapen great vessels. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 63 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2810403A07Rik	T	C	3: 88,686,329		probably benign	Het
4930544D05Rik	A	G	11: 70,616,648	Q173R	possibly damaging	Het
Ampd2	C	T	3: 108,086,716		probably benign	Het
Ankrd17	T	C	5: 90,254,799	S1467G	possibly damaging	Het
Arhgap31	T	G	16: 38,602,510	S1065R	possibly damaging	Het
Arhgef19	G	T	4: 141,250,607	M542I	probably benign	Het
C7	T	C	15: 5,015,380	D392G	possibly damaging	Het
Ccdc138	G	A	10: 58,575,823	C671Y	probably damaging	Het
Cdh8	A	G	8: 99,111,715	S498P	possibly damaging	Het
Cpb2	T	A	14: 75,257,709		probably null	Het
Cwc22	A	C	2: 77,920,858	N389K	probably benign	Het
Dgkb	T	A	12: 38,228,026	L550Q	probably damaging	Het
Dip2c	A	G	13: 9,615,775	R950G	probably damaging	Het
Eml6	A	G	11: 29,848,949	V437A	possibly damaging	Het
Fanca	T	C	8: 123,272,441		probably benign	Het
Fgd2	C	G	17: 29,367,008	L189V	possibly damaging	Het
Foxred2	A	C	15: 77,943,390	S590A	possibly damaging	Het
Gm1110	A	G	9: 26,920,666	F63S	probably damaging	Het
Gm14496	A	T	2: 181,995,954	M274L	probably benign	Het
Gm7008	T	A	12: 40,223,560		probably benign	Het
Gm9922	T	A	14: 101,729,553		probably benign	Het
Gtf3c3	A	T	1: 54,428,812	M222K	possibly damaging	Het
Hspa1b	A	G	17: 34,958,832	V59A	probably benign	Het
Impg1	T	C	9: 80,386,879		probably benign	Het
Lpcat4	T	A	2: 112,243,245		probably null	Het
Mipol1	T	C	12: 57,460,954		probably benign	Het
Mrpl37	C	A	4: 107,066,461	R112L	possibly damaging	Het
Myo18b	T	C	5: 112,809,685	N1471D	possibly damaging	Het
Nes	G	A	3: 87,978,642	E1359K	possibly damaging	Het
Nipbl	A	T	15: 8,361,737	V251E	possibly damaging	Het
Nlrp1b	T	C	11: 71,161,765	I946V	possibly damaging	Het
Obscn	T	G	11: 59,056,742		probably benign	Het
Olfr1024	A	T	2: 85,904,289	M255K	possibly damaging	Het
Olfr1239	T	A	2: 89,418,158	Y85F	probably benign	Het
Olfr1491	A	T	19: 13,705,135	T103S	probably benign	Het
Olfr635	T	A	7: 103,979,630	I146K	possibly damaging	Het
Pck2	T	C	14: 55,544,584		probably null	Het
Pcsk9	A	G	4: 106,449,049		probably benign	Het
Phyhd1	A	T	2: 30,269,822	Q56L	probably benign	Het
Plxnc1	C	T	10: 94,837,918	G1001S	probably null	Het
Prss52	T	C	14: 64,113,678	V304A	probably benign	Het
Prss55	C	T	14: 64,075,607	G276D	probably benign	Het
Pzp	A	T	6: 128,519,514	Y252N	probably damaging	Het
Rad1	T	C	15: 10,490,457		probably null	Het
Rpp30	T	A	19: 36,104,403	D255E	probably benign	Het
Rsad1	T	C	11: 94,548,464		probably benign	Het
Serpini2	A	G	3: 75,246,578	M358T	probably damaging	Het
Slc35a1	T	A	4: 34,664,125	E331V	probably benign	Het
Slc38a7	A	G	8: 95,845,878	F179L	probably damaging	Het
Stmn4	C	T	14: 66,356,283	Q42*	probably null	Het
Sytl2	T	C	7: 90,403,020		probably benign	Het
Tab2	G	A	10: 7,919,158	A520V	probably benign	Het
Tcp10a	A	G	17: 7,331,156	I162M	probably benign	Het
Tmprss13	A	G	9: 45,333,688		probably benign	Het
Tnfrsf14	A	G	4: 154,926,597		probably null	Het
Tpx2	A	G	2: 152,867,367		probably benign	Het
Vmn2r105	T	A	17: 20,234,703	N57I	probably damaging	Het
Wars	C	T	12: 108,875,193	V220I	probably benign	Het
Washc1	T	A	17: 66,116,719	D212E	possibly damaging	Het
Wdr17	C	T	8: 54,693,096	A90T	possibly damaging	Het
Wdr43	A	G	17: 71,626,825	D139G	probably benign	Het
Zfp235	A	T	7: 24,137,131	H34L	possibly damaging	Het
Zkscan16	G	A	4: 58,952,391	V230I	probably benign	Het

Other mutations in Ripply3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01431:Ripply3	APN	16	94328543	missense	possibly damaging	0.89
R4568:Ripply3	UTSW	16	94335829	missense	probably damaging	1.00
R7400:Ripply3	UTSW	16	94335900	missense	probably benign	0.32
R8021:Ripply3	UTSW	16	94328510	missense	probably benign	0.05

Predicted Primers

PCR Primer
(F):5'- TTAGAGCCCAGTGTCTTCGTAGCC -3'
(R):5'- AGAATCCCTGACTTCTGCCTCCAG -3'

Sequencing Primer
(F):5'- TTTTAGCGAGTCCCTCAGAAG -3'
(R):5'- TGCCTCCAGGCACTGAAG -3'

Posted On

2013-05-09