Incidental Mutation 'R4712:Sh3rf1'
ID353312
Institutional Source Beutler Lab
Gene Symbol Sh3rf1
Ensembl Gene ENSMUSG00000031642
Gene NameSH3 domain containing ring finger 1
SynonymsSh3md2, Posh, 2200003J05Rik
MMRRC Submission 041981-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.373) question?
Stock #R4712 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location61223872-61396071 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 61361759 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 451 (T451A)
Ref Sequence ENSEMBL: ENSMUSP00000148118 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034060] [ENSMUST00000209611]
Predicted Effect probably benign
Transcript: ENSMUST00000034060
AA Change: T451A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000034060
Gene: ENSMUSG00000031642
AA Change: T451A

DomainStartEndE-ValueType
RING 12 52 5.3e-9 SMART
low complexity region 83 90 N/A INTRINSIC
SH3 137 192 1.67e-18 SMART
SH3 199 258 4.84e-15 SMART
low complexity region 366 376 N/A INTRINSIC
low complexity region 397 405 N/A INTRINSIC
low complexity region 417 430 N/A INTRINSIC
SH3 454 511 7.92e-20 SMART
low complexity region 558 569 N/A INTRINSIC
low complexity region 638 651 N/A INTRINSIC
low complexity region 700 734 N/A INTRINSIC
SH3 835 891 1.47e-14 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000072570
Predicted Effect probably benign
Transcript: ENSMUST00000209611
AA Change: T451A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210210
Meta Mutation Damage Score 0.0600 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.3%
Validation Efficiency 98% (54/55)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein containing an N-terminus RING-finger, four SH3 domains, and a region implicated in binding of the Rho GTPase Rac. Via the RING-finger, the encoded protein has been shown to function as an ubiquitin-protein ligase involved in protein sorting at the trans-Golgi network. The encoded protein may also act as a scaffold for the c-Jun N-terminal kinase signaling pathway, facilitating the formation of a functional signaling module. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210016F16Rik G A 13: 58,381,803 R332C probably benign Het
2900055J20Rik G T 18: 40,257,180 probably benign Het
A4galt G T 15: 83,227,609 N324K probably damaging Het
Ahcyl1 A G 3: 107,667,231 probably benign Het
Atrnl1 T A 19: 57,652,950 N343K probably benign Het
Batf2 C A 19: 6,171,327 Q56K probably benign Het
Cfh A T 1: 140,108,536 V691D probably damaging Het
Chst10 T C 1: 38,865,841 Y257C probably damaging Het
Dlg5 A T 14: 24,177,983 L290Q possibly damaging Het
Dnah2 T A 11: 69,516,590 T456S possibly damaging Het
Dnah6 T C 6: 73,025,012 probably null Het
Efhb T C 17: 53,451,669 K313R probably damaging Het
Eprs T A 1: 185,428,108 N1500K probably benign Het
Fbn1 T C 2: 125,341,316 T1748A probably benign Het
Gfra2 T A 14: 70,925,937 L87H probably damaging Het
Gfral T A 9: 76,193,445 Y237F possibly damaging Het
Gpr137b T C 13: 13,359,389 N361D probably benign Het
Gsdmc G T 15: 63,779,537 T272N probably benign Het
Hspe1 T A 1: 55,089,110 S21R probably benign Het
Kif21a A T 15: 90,984,755 I483N probably damaging Het
Kif4-ps T C 12: 101,146,275 noncoding transcript Het
Lpp T C 16: 24,761,657 V166A possibly damaging Het
Lrp2 A C 2: 69,506,551 D1292E probably damaging Het
Manba T C 3: 135,544,814 Y401H probably damaging Het
Msh2 T G 17: 87,678,385 probably benign Het
Myef2 A T 2: 125,088,837 probably benign Het
Ncor1 T A 11: 62,344,834 Q598L probably damaging Het
Obox3 A G 7: 15,626,839 V125A probably benign Het
Olfr124 T A 17: 37,805,700 L185* probably null Het
Olfr351 A T 2: 36,860,369 probably null Het
Olfr827 G A 10: 130,210,422 T236I possibly damaging Het
Pcdh9 C A 14: 93,888,631 L34F probably damaging Het
Pcdha3 A T 18: 36,946,507 I101F probably damaging Het
Pced1b A G 15: 97,384,794 E238G probably benign Het
Pla2r1 A T 2: 60,428,650 N1131K probably damaging Het
Prmt1 A T 7: 44,981,636 S99R probably damaging Het
Rbp3 T C 14: 33,960,658 S1116P probably damaging Het
Rhobtb2 T C 14: 69,799,711 D88G probably damaging Het
Rngtt A G 4: 33,379,394 E432G probably benign Het
Shroom3 G T 5: 92,943,086 V1151F probably damaging Het
Siva1 T A 12: 112,646,902 D61E probably benign Het
Skor1 A C 9: 63,139,573 probably null Het
Slc20a1 A G 2: 129,199,691 probably benign Het
Slc2a7 A G 4: 150,168,469 E522G probably benign Het
Tmprss7 A T 16: 45,690,760 I85N probably damaging Het
Tpx2 T A 2: 152,885,038 D408E probably damaging Het
Ulk4 A T 9: 121,244,370 I551N probably benign Het
Zfat A T 15: 68,110,475 probably null Het
Zfp101 C A 17: 33,394,483 probably null Het
Other mutations in Sh3rf1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01066:Sh3rf1 APN 8 61329336 missense probably damaging 1.00
IGL01071:Sh3rf1 APN 8 61225959 missense probably damaging 1.00
IGL01485:Sh3rf1 APN 8 61329331 missense possibly damaging 0.79
IGL01587:Sh3rf1 APN 8 61226058 missense probably damaging 0.99
IGL02412:Sh3rf1 APN 8 61372689 missense probably benign 0.35
IGL02649:Sh3rf1 APN 8 61363191 missense probably damaging 1.00
limpid UTSW 8 61329258 missense probably damaging 1.00
IGL02835:Sh3rf1 UTSW 8 61226047 missense probably damaging 1.00
R0009:Sh3rf1 UTSW 8 61226293 missense probably damaging 0.97
R0016:Sh3rf1 UTSW 8 61374138 missense probably benign 0.18
R0040:Sh3rf1 UTSW 8 61329252 missense possibly damaging 0.96
R0040:Sh3rf1 UTSW 8 61329252 missense possibly damaging 0.96
R0278:Sh3rf1 UTSW 8 61374018 missense probably damaging 1.00
R0395:Sh3rf1 UTSW 8 61393662 splice site probably benign
R0733:Sh3rf1 UTSW 8 61372560 missense probably benign 0.00
R0790:Sh3rf1 UTSW 8 61329258 missense probably damaging 1.00
R1028:Sh3rf1 UTSW 8 61393787 missense possibly damaging 0.94
R1569:Sh3rf1 UTSW 8 61384862 missense probably damaging 1.00
R1654:Sh3rf1 UTSW 8 61361745 missense possibly damaging 0.92
R1799:Sh3rf1 UTSW 8 61372627 missense probably damaging 0.99
R1960:Sh3rf1 UTSW 8 61384863 missense probably damaging 1.00
R2181:Sh3rf1 UTSW 8 61363238 missense probably damaging 0.98
R2184:Sh3rf1 UTSW 8 61372654 missense probably damaging 0.99
R2330:Sh3rf1 UTSW 8 61226287 missense probably benign 0.01
R2331:Sh3rf1 UTSW 8 61226287 missense probably benign 0.01
R2332:Sh3rf1 UTSW 8 61226287 missense probably benign 0.01
R2967:Sh3rf1 UTSW 8 61226287 missense probably benign 0.01
R2994:Sh3rf1 UTSW 8 61372575 missense probably benign 0.10
R3159:Sh3rf1 UTSW 8 61226287 missense probably benign 0.01
R3195:Sh3rf1 UTSW 8 61226287 missense probably benign 0.01
R3196:Sh3rf1 UTSW 8 61226287 missense probably benign 0.01
R3724:Sh3rf1 UTSW 8 61372722 missense probably benign
R4692:Sh3rf1 UTSW 8 61353854 splice site probably null
R5214:Sh3rf1 UTSW 8 61372731 missense probably damaging 0.98
R5409:Sh3rf1 UTSW 8 61374245 missense probably benign 0.01
R5590:Sh3rf1 UTSW 8 61361732 missense probably benign 0.11
R5651:Sh3rf1 UTSW 8 61363167 missense probably damaging 1.00
R6976:Sh3rf1 UTSW 8 61361732 nonsense probably null
R7126:Sh3rf1 UTSW 8 61349424 missense probably benign 0.01
R7154:Sh3rf1 UTSW 8 61372714 missense possibly damaging 0.89
R7625:Sh3rf1 UTSW 8 61372722 missense probably benign
R7747:Sh3rf1 UTSW 8 61353753 missense probably damaging 0.97
X0066:Sh3rf1 UTSW 8 61226197 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GAGTATGAATCCTCCACTTCCC -3'
(R):5'- CGAAAGGCCTTTTCTCAGCG -3'

Sequencing Primer
(F):5'- GAATCCTCCACTTCCCCCACC -3'
(R):5'- GGCTCACATTAGGCTCATTCTAAGTG -3'
Posted On2015-10-21