Incidental Mutation 'R4712:Ulk4'
ID353314
Institutional Source Beutler Lab
Gene Symbol Ulk4
Ensembl Gene ENSMUSG00000040936
Gene Nameunc-51-like kinase 4
Synonyms4932415A06Rik
MMRRC Submission 041981-MU
Accession Numbers

Genbank: NM_177589; MGI: 1921622

Is this an essential gene? Possibly non essential (E-score: 0.489) question?
Stock #R4712 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location120955351-121277197 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 121244370 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 551 (I551N)
Ref Sequence ENSEMBL: ENSMUSP00000129214 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051479] [ENSMUST00000051565] [ENSMUST00000170237] [ENSMUST00000171061] [ENSMUST00000171923]
Predicted Effect probably benign
Transcript: ENSMUST00000051479
AA Change: I551N

PolyPhen 2 Score 0.229 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000057960
Gene: ENSMUSG00000040936
AA Change: I551N

DomainStartEndE-ValueType
Pfam:Pkinase_Tyr 4 277 9.9e-26 PFAM
Pfam:Pkinase 4 280 4.6e-49 PFAM
low complexity region 949 964 N/A INTRINSIC
low complexity region 968 985 N/A INTRINSIC
low complexity region 1107 1119 N/A INTRINSIC
low complexity region 1147 1161 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000051565
SMART Domains Protein: ENSMUSP00000054833
Gene: ENSMUSG00000040936

DomainStartEndE-ValueType
SCOP:d1jvpp_ 1 32 9e-6 SMART
Blast:S_TKc 4 45 2e-8 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000122757
Predicted Effect noncoding transcript
Transcript: ENSMUST00000164336
Predicted Effect probably benign
Transcript: ENSMUST00000170237
Predicted Effect probably benign
Transcript: ENSMUST00000171061
AA Change: I551N

PolyPhen 2 Score 0.229 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000129214
Gene: ENSMUSG00000040936
AA Change: I551N

DomainStartEndE-ValueType
Pfam:Pkinase_Tyr 4 277 4.3e-26 PFAM
Pfam:Pkinase 4 280 2.1e-49 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000171923
AA Change: I551N

PolyPhen 2 Score 0.221 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000131342
Gene: ENSMUSG00000040936
AA Change: I551N

DomainStartEndE-ValueType
Pfam:Pkinase_Tyr 4 153 3.1e-14 PFAM
Pfam:Pkinase 4 280 4.9e-50 PFAM
Pfam:Pkinase_Tyr 165 277 6.1e-10 PFAM
low complexity region 949 964 N/A INTRINSIC
low complexity region 968 985 N/A INTRINSIC
low complexity region 1107 1119 N/A INTRINSIC
low complexity region 1147 1171 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000172397
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.3%
Validation Efficiency 98% (54/55)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the unc-51-like serine/threonine kinase (STK) family. Members of this protein family play a role in neuronal growth and endocytosis. The encoded protein is likely involved in neurite branching, neurite elongation and neuronal migration. Genome-wide association studies (GWAS) indicate an association of variations in this gene with blood pressure and hypertension. Sequence variations in this gene may also be be associated with psychiatric disorders, including schizophrenia and bipolar disorder. Pseudogenes associated with this gene have been identified and are located on chromosome 15. [provided by RefSeq, Jul 2016]
PHENOTYPE: Homozygotes for a null allele show reduced body size, hydrocephaly, dilated brain ventricles, otitis media, and premature death. Hypomorphic mice show partial corpus callosum aplasia, hydrocephaly, subcommissural organ and ependymal motile ciliary defects, aqueduct stenosis, and impaired CSF flow. [provided by MGI curators]
Allele List at MGI

All alleles(2) : Targeted, other(1) Gene trapped(1)

Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210016F16Rik G A 13: 58,381,803 R332C probably benign Het
2900055J20Rik G T 18: 40,257,180 probably benign Het
A4galt G T 15: 83,227,609 N324K probably damaging Het
Ahcyl1 A G 3: 107,667,231 probably benign Het
Atrnl1 T A 19: 57,652,950 N343K probably benign Het
Batf2 C A 19: 6,171,327 Q56K probably benign Het
Cfh A T 1: 140,108,536 V691D probably damaging Het
Chst10 T C 1: 38,865,841 Y257C probably damaging Het
Dlg5 A T 14: 24,177,983 L290Q possibly damaging Het
Dnah2 T A 11: 69,516,590 T456S possibly damaging Het
Dnah6 T C 6: 73,025,012 probably null Het
Efhb T C 17: 53,451,669 K313R probably damaging Het
Eprs T A 1: 185,428,108 N1500K probably benign Het
Fbn1 T C 2: 125,341,316 T1748A probably benign Het
Gfra2 T A 14: 70,925,937 L87H probably damaging Het
Gfral T A 9: 76,193,445 Y237F possibly damaging Het
Gpr137b T C 13: 13,359,389 N361D probably benign Het
Gsdmc G T 15: 63,779,537 T272N probably benign Het
Hspe1 T A 1: 55,089,110 S21R probably benign Het
Kif21a A T 15: 90,984,755 I483N probably damaging Het
Kif4-ps T C 12: 101,146,275 noncoding transcript Het
Lpp T C 16: 24,761,657 V166A possibly damaging Het
Lrp2 A C 2: 69,506,551 D1292E probably damaging Het
Manba T C 3: 135,544,814 Y401H probably damaging Het
Msh2 T G 17: 87,678,385 probably benign Het
Myef2 A T 2: 125,088,837 probably benign Het
Ncor1 T A 11: 62,344,834 Q598L probably damaging Het
Obox3 A G 7: 15,626,839 V125A probably benign Het
Olfr124 T A 17: 37,805,700 L185* probably null Het
Olfr351 A T 2: 36,860,369 probably null Het
Olfr827 G A 10: 130,210,422 T236I possibly damaging Het
Pcdh9 C A 14: 93,888,631 L34F probably damaging Het
Pcdha3 A T 18: 36,946,507 I101F probably damaging Het
Pced1b A G 15: 97,384,794 E238G probably benign Het
Pla2r1 A T 2: 60,428,650 N1131K probably damaging Het
Prmt1 A T 7: 44,981,636 S99R probably damaging Het
Rbp3 T C 14: 33,960,658 S1116P probably damaging Het
Rhobtb2 T C 14: 69,799,711 D88G probably damaging Het
Rngtt A G 4: 33,379,394 E432G probably benign Het
Sh3rf1 A G 8: 61,361,759 T451A probably benign Het
Shroom3 G T 5: 92,943,086 V1151F probably damaging Het
Siva1 T A 12: 112,646,902 D61E probably benign Het
Skor1 A C 9: 63,139,573 probably null Het
Slc20a1 A G 2: 129,199,691 probably benign Het
Slc2a7 A G 4: 150,168,469 E522G probably benign Het
Tmprss7 A T 16: 45,690,760 I85N probably damaging Het
Tpx2 T A 2: 152,885,038 D408E probably damaging Het
Zfat A T 15: 68,110,475 probably null Het
Zfp101 C A 17: 33,394,483 probably null Het
Other mutations in Ulk4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01122:Ulk4 APN 9 121168292 missense possibly damaging 0.48
IGL01345:Ulk4 APN 9 121208162 missense possibly damaging 0.48
IGL01432:Ulk4 APN 9 121266301 missense probably damaging 1.00
IGL01807:Ulk4 APN 9 121255185 missense probably damaging 1.00
IGL02139:Ulk4 APN 9 121141831 splice site probably null
IGL02266:Ulk4 APN 9 121081700 missense probably benign 0.10
IGL02511:Ulk4 APN 9 121188354 missense probably damaging 1.00
IGL02546:Ulk4 APN 9 121152307 nonsense probably null
IGL02687:Ulk4 APN 9 121192662 missense possibly damaging 0.89
IGL03220:Ulk4 APN 9 121145336 missense probably damaging 1.00
3-1:Ulk4 UTSW 9 121255171 missense probably benign 0.02
R0031:Ulk4 UTSW 9 121272982 missense probably damaging 1.00
R0433:Ulk4 UTSW 9 121044819 missense probably benign 0.27
R0513:Ulk4 UTSW 9 121152325 missense probably benign 0.13
R0524:Ulk4 UTSW 9 121252651 critical splice donor site probably null
R1268:Ulk4 UTSW 9 121257074 splice site probably benign
R1439:Ulk4 UTSW 9 121266258 missense possibly damaging 0.58
R1470:Ulk4 UTSW 9 121081656 missense probably benign 0.00
R1470:Ulk4 UTSW 9 121081656 missense probably benign 0.00
R1531:Ulk4 UTSW 9 121044775 missense probably damaging 0.97
R1595:Ulk4 UTSW 9 121044838 missense probably damaging 0.96
R1620:Ulk4 UTSW 9 121204805 missense possibly damaging 0.81
R1835:Ulk4 UTSW 9 121168184 missense probably null 1.00
R1966:Ulk4 UTSW 9 121257116 missense probably benign
R2129:Ulk4 UTSW 9 121152182 missense probably benign 0.03
R2329:Ulk4 UTSW 9 121272887 missense probably damaging 1.00
R2877:Ulk4 UTSW 9 121260039 missense probably benign 0.11
R2878:Ulk4 UTSW 9 121260039 missense probably benign 0.11
R3734:Ulk4 UTSW 9 121261989 missense probably benign 0.21
R3769:Ulk4 UTSW 9 121263700 missense probably benign 0.00
R4005:Ulk4 UTSW 9 121168199 missense possibly damaging 0.94
R4024:Ulk4 UTSW 9 121044849 missense possibly damaging 0.86
R4321:Ulk4 UTSW 9 121073996 missense probably benign 0.00
R4461:Ulk4 UTSW 9 121156884 missense possibly damaging 0.83
R4537:Ulk4 UTSW 9 121263638 nonsense probably null
R4542:Ulk4 UTSW 9 121263638 nonsense probably null
R4572:Ulk4 UTSW 9 121192764 missense probably damaging 1.00
R4647:Ulk4 UTSW 9 121141852 missense probably benign 0.15
R4730:Ulk4 UTSW 9 121263725 missense probably benign 0.05
R4731:Ulk4 UTSW 9 121263638 nonsense probably null
R4732:Ulk4 UTSW 9 121263638 nonsense probably null
R4733:Ulk4 UTSW 9 121263638 nonsense probably null
R4737:Ulk4 UTSW 9 121073872 nonsense probably null
R4781:Ulk4 UTSW 9 121103576 missense probably benign 0.00
R4860:Ulk4 UTSW 9 121250902 missense possibly damaging 0.68
R4926:Ulk4 UTSW 9 121258732 missense probably benign 0.00
R4990:Ulk4 UTSW 9 121192786 missense probably benign 0.01
R6056:Ulk4 UTSW 9 121272955 missense probably damaging 1.00
R6448:Ulk4 UTSW 9 121103630 missense probably damaging 0.99
R6546:Ulk4 UTSW 9 121141894 missense probably damaging 1.00
R6668:Ulk4 UTSW 9 121188342 missense probably damaging 1.00
R6915:Ulk4 UTSW 9 121258820 missense probably benign
R6929:Ulk4 UTSW 9 121074015 missense probably benign 0.02
R7069:Ulk4 UTSW 9 121258810 missense probably benign 0.01
R7069:Ulk4 UTSW 9 121266517 missense probably benign 0.25
R7293:Ulk4 UTSW 9 121255124 missense probably damaging 1.00
R7299:Ulk4 UTSW 9 121145059 missense probably benign 0.32
R7301:Ulk4 UTSW 9 121145059 missense probably benign 0.32
R7337:Ulk4 UTSW 9 121248927 missense probably benign 0.44
R7395:Ulk4 UTSW 9 121255112 missense probably benign
R7423:Ulk4 UTSW 9 121103621 missense possibly damaging 0.48
R7545:Ulk4 UTSW 9 121141838 missense probably benign 0.00
R7753:Ulk4 UTSW 9 121266512 critical splice donor site probably null
R7790:Ulk4 UTSW 9 121263668 missense possibly damaging 0.70
R7791:Ulk4 UTSW 9 121263668 missense possibly damaging 0.70
R7793:Ulk4 UTSW 9 121263668 missense possibly damaging 0.70
R7834:Ulk4 UTSW 9 121263668 missense possibly damaging 0.70
R7836:Ulk4 UTSW 9 121044819 missense possibly damaging 0.72
R7960:Ulk4 UTSW 9 121272956 missense probably damaging 1.00
R8087:Ulk4 UTSW 9 121266251 missense probably damaging 0.99
R8203:Ulk4 UTSW 9 121168208 missense probably damaging 0.96
R8246:Ulk4 UTSW 9 121156875 makesense probably null
R8430:Ulk4 UTSW 9 121257078 critical splice donor site probably null
X0024:Ulk4 UTSW 9 121192753 missense probably damaging 1.00
X0066:Ulk4 UTSW 9 121262606 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTGTAAGTTAGAGCCCACAGAGG -3'
(R):5'- TGTACGTGACAGGGAGTTTC -3'

Sequencing Primer
(F):5'- CCACAGAGGGTCCCAAGG -3'
(R):5'- GGTTGAACTCAGGTCATCACACTTG -3'
Posted On2015-10-21