Incidental Mutation 'R4712:Olfr827'
ID353315
Institutional Source Beutler Lab
Gene Symbol Olfr827
Ensembl Gene ENSMUSG00000045559
Gene Nameolfactory receptor 827
SynonymsMOR210-5, GA_x6K02T2PULF-11878777-11877809
MMRRC Submission 041981-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.101) question?
Stock #R4712 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location130203049-130214403 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 130210422 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 236 (T236I)
Ref Sequence ENSEMBL: ENSMUSP00000149200 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000058123] [ENSMUST00000213568]
Predicted Effect possibly damaging
Transcript: ENSMUST00000058123
AA Change: T236I

PolyPhen 2 Score 0.777 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000089609
Gene: ENSMUSG00000045559
AA Change: T236I

DomainStartEndE-ValueType
Pfam:7tm_4 43 318 6e-53 PFAM
Pfam:7tm_1 53 300 2.5e-25 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000213568
AA Change: T236I

PolyPhen 2 Score 0.777 (Sensitivity: 0.85; Specificity: 0.92)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000216253
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.3%
Validation Efficiency 98% (54/55)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210016F16Rik G A 13: 58,381,803 R332C probably benign Het
2900055J20Rik G T 18: 40,257,180 probably benign Het
A4galt G T 15: 83,227,609 N324K probably damaging Het
Ahcyl1 A G 3: 107,667,231 probably benign Het
Atrnl1 T A 19: 57,652,950 N343K probably benign Het
Batf2 C A 19: 6,171,327 Q56K probably benign Het
Cfh A T 1: 140,108,536 V691D probably damaging Het
Chst10 T C 1: 38,865,841 Y257C probably damaging Het
Dlg5 A T 14: 24,177,983 L290Q possibly damaging Het
Dnah2 T A 11: 69,516,590 T456S possibly damaging Het
Dnah6 T C 6: 73,025,012 probably null Het
Efhb T C 17: 53,451,669 K313R probably damaging Het
Eprs T A 1: 185,428,108 N1500K probably benign Het
Fbn1 T C 2: 125,341,316 T1748A probably benign Het
Gfra2 T A 14: 70,925,937 L87H probably damaging Het
Gfral T A 9: 76,193,445 Y237F possibly damaging Het
Gpr137b T C 13: 13,359,389 N361D probably benign Het
Gsdmc G T 15: 63,779,537 T272N probably benign Het
Hspe1 T A 1: 55,089,110 S21R probably benign Het
Kif21a A T 15: 90,984,755 I483N probably damaging Het
Kif4-ps T C 12: 101,146,275 noncoding transcript Het
Lpp T C 16: 24,761,657 V166A possibly damaging Het
Lrp2 A C 2: 69,506,551 D1292E probably damaging Het
Manba T C 3: 135,544,814 Y401H probably damaging Het
Msh2 T G 17: 87,678,385 probably benign Het
Myef2 A T 2: 125,088,837 probably benign Het
Ncor1 T A 11: 62,344,834 Q598L probably damaging Het
Obox3 A G 7: 15,626,839 V125A probably benign Het
Olfr124 T A 17: 37,805,700 L185* probably null Het
Olfr351 A T 2: 36,860,369 probably null Het
Pcdh9 C A 14: 93,888,631 L34F probably damaging Het
Pcdha3 A T 18: 36,946,507 I101F probably damaging Het
Pced1b A G 15: 97,384,794 E238G probably benign Het
Pla2r1 A T 2: 60,428,650 N1131K probably damaging Het
Prmt1 A T 7: 44,981,636 S99R probably damaging Het
Rbp3 T C 14: 33,960,658 S1116P probably damaging Het
Rhobtb2 T C 14: 69,799,711 D88G probably damaging Het
Rngtt A G 4: 33,379,394 E432G probably benign Het
Sh3rf1 A G 8: 61,361,759 T451A probably benign Het
Shroom3 G T 5: 92,943,086 V1151F probably damaging Het
Siva1 T A 12: 112,646,902 D61E probably benign Het
Skor1 A C 9: 63,139,573 probably null Het
Slc20a1 A G 2: 129,199,691 probably benign Het
Slc2a7 A G 4: 150,168,469 E522G probably benign Het
Tmprss7 A T 16: 45,690,760 I85N probably damaging Het
Tpx2 T A 2: 152,885,038 D408E probably damaging Het
Ulk4 A T 9: 121,244,370 I551N probably benign Het
Zfat A T 15: 68,110,475 probably null Het
Zfp101 C A 17: 33,394,483 probably null Het
Other mutations in Olfr827
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02351:Olfr827 APN 10 130210734 missense probably damaging 1.00
IGL02358:Olfr827 APN 10 130210734 missense probably damaging 1.00
R0179:Olfr827 UTSW 10 130210338 missense probably damaging 1.00
R0401:Olfr827 UTSW 10 130210620 missense probably damaging 1.00
R0607:Olfr827 UTSW 10 130211070 missense probably benign 0.33
R1139:Olfr827 UTSW 10 130211079 missense possibly damaging 0.53
R1462:Olfr827 UTSW 10 130210723 missense probably benign 0.30
R1462:Olfr827 UTSW 10 130210723 missense probably benign 0.30
R1645:Olfr827 UTSW 10 130210212 missense probably damaging 0.99
R4966:Olfr827 UTSW 10 130210437 missense probably benign 0.31
R5219:Olfr827 UTSW 10 130210924 missense possibly damaging 0.84
R6363:Olfr827 UTSW 10 130211037 missense possibly damaging 0.93
R6734:Olfr827 UTSW 10 130210257 missense probably benign 0.31
R6909:Olfr827 UTSW 10 130210753 missense probably benign
R7180:Olfr827 UTSW 10 130210942 missense probably benign 0.05
R7549:Olfr827 UTSW 10 130210984 missense probably benign 0.01
R7665:Olfr827 UTSW 10 130211261 splice site probably null
R8001:Olfr827 UTSW 10 130210860 missense probably benign
Predicted Primers PCR Primer
(F):5'- TAGGGGATTCAACATAGGTGTG -3'
(R):5'- GGTCAGTTCCATCCTCCAAATC -3'

Sequencing Primer
(F):5'- TTTGGAGGTGTGAGATACA -3'
(R):5'- GTTCCATCCTCCAAATCAGTGTAAC -3'
Posted On2015-10-21