Incidental Mutation 'R4712:Rhobtb2'
ID353324
Institutional Source Beutler Lab
Gene Symbol Rhobtb2
Ensembl Gene ENSMUSG00000022075
Gene NameRho-related BTB domain containing 2
SynonymsDbc2, E130206H14Rik
MMRRC Submission 041981-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4712 (G1)
Quality Score225
Status Validated
Chromosome14
Chromosomal Location69784990-69805636 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 69799711 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 88 (D88G)
Ref Sequence ENSEMBL: ENSMUSP00000022665 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022665]
Predicted Effect probably damaging
Transcript: ENSMUST00000022665
AA Change: D88G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000022665
Gene: ENSMUSG00000022075
AA Change: D88G

DomainStartEndE-ValueType
RHO 17 210 4.86e-36 SMART
low complexity region 227 249 N/A INTRINSIC
BTB 266 472 5.27e-15 SMART
BTB 500 598 2.78e-14 SMART
low complexity region 706 726 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223603
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224535
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225088
Meta Mutation Damage Score 0.9369 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.3%
Validation Efficiency 98% (54/55)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a small Rho GTPase and a candidate tumor suppressor. The encoded protein interacts with the cullin-3 protein, a ubiquitin E3 ligase necessary for mitotic cell division. This protein inhibits the growth and spread of some types of breast cancer. Three transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Nov 2011]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210016F16Rik G A 13: 58,381,803 R332C probably benign Het
2900055J20Rik G T 18: 40,257,180 probably benign Het
A4galt G T 15: 83,227,609 N324K probably damaging Het
Ahcyl1 A G 3: 107,667,231 probably benign Het
Atrnl1 T A 19: 57,652,950 N343K probably benign Het
Batf2 C A 19: 6,171,327 Q56K probably benign Het
Cfh A T 1: 140,108,536 V691D probably damaging Het
Chst10 T C 1: 38,865,841 Y257C probably damaging Het
Dlg5 A T 14: 24,177,983 L290Q possibly damaging Het
Dnah2 T A 11: 69,516,590 T456S possibly damaging Het
Dnah6 T C 6: 73,025,012 probably null Het
Efhb T C 17: 53,451,669 K313R probably damaging Het
Eprs T A 1: 185,428,108 N1500K probably benign Het
Fbn1 T C 2: 125,341,316 T1748A probably benign Het
Gfra2 T A 14: 70,925,937 L87H probably damaging Het
Gfral T A 9: 76,193,445 Y237F possibly damaging Het
Gpr137b T C 13: 13,359,389 N361D probably benign Het
Gsdmc G T 15: 63,779,537 T272N probably benign Het
Hspe1 T A 1: 55,089,110 S21R probably benign Het
Kif21a A T 15: 90,984,755 I483N probably damaging Het
Kif4-ps T C 12: 101,146,275 noncoding transcript Het
Lpp T C 16: 24,761,657 V166A possibly damaging Het
Lrp2 A C 2: 69,506,551 D1292E probably damaging Het
Manba T C 3: 135,544,814 Y401H probably damaging Het
Msh2 T G 17: 87,678,385 probably benign Het
Myef2 A T 2: 125,088,837 probably benign Het
Ncor1 T A 11: 62,344,834 Q598L probably damaging Het
Obox3 A G 7: 15,626,839 V125A probably benign Het
Olfr124 T A 17: 37,805,700 L185* probably null Het
Olfr351 A T 2: 36,860,369 probably null Het
Olfr827 G A 10: 130,210,422 T236I possibly damaging Het
Pcdh9 C A 14: 93,888,631 L34F probably damaging Het
Pcdha3 A T 18: 36,946,507 I101F probably damaging Het
Pced1b A G 15: 97,384,794 E238G probably benign Het
Pla2r1 A T 2: 60,428,650 N1131K probably damaging Het
Prmt1 A T 7: 44,981,636 S99R probably damaging Het
Rbp3 T C 14: 33,960,658 S1116P probably damaging Het
Rngtt A G 4: 33,379,394 E432G probably benign Het
Sh3rf1 A G 8: 61,361,759 T451A probably benign Het
Shroom3 G T 5: 92,943,086 V1151F probably damaging Het
Siva1 T A 12: 112,646,902 D61E probably benign Het
Skor1 A C 9: 63,139,573 probably null Het
Slc20a1 A G 2: 129,199,691 probably benign Het
Slc2a7 A G 4: 150,168,469 E522G probably benign Het
Tmprss7 A T 16: 45,690,760 I85N probably damaging Het
Tpx2 T A 2: 152,885,038 D408E probably damaging Het
Ulk4 A T 9: 121,244,370 I551N probably benign Het
Zfat A T 15: 68,110,475 probably null Het
Zfp101 C A 17: 33,394,483 probably null Het
Other mutations in Rhobtb2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01482:Rhobtb2 APN 14 69796588 missense possibly damaging 0.82
IGL02437:Rhobtb2 APN 14 69795916 missense probably damaging 1.00
Paunchy UTSW 14 69798178 missense probably damaging 1.00
reeses UTSW 14 69799711 missense probably damaging 1.00
smoke UTSW 14 69796444 missense probably damaging 0.99
waft UTSW 14 69796735 missense probably benign 0.22
R0034:Rhobtb2 UTSW 14 69788688 missense probably benign
R0149:Rhobtb2 UTSW 14 69795908 missense probably benign 0.02
R0361:Rhobtb2 UTSW 14 69795908 missense probably benign 0.02
R0376:Rhobtb2 UTSW 14 69796735 missense probably benign 0.22
R0594:Rhobtb2 UTSW 14 69793948 missense probably benign
R1005:Rhobtb2 UTSW 14 69798277 missense probably damaging 1.00
R1072:Rhobtb2 UTSW 14 69787527 small deletion probably benign
R1929:Rhobtb2 UTSW 14 69796444 missense probably damaging 0.99
R1938:Rhobtb2 UTSW 14 69796613 missense probably benign 0.01
R2058:Rhobtb2 UTSW 14 69794039 missense possibly damaging 0.49
R2244:Rhobtb2 UTSW 14 69787527 small deletion probably benign
R2992:Rhobtb2 UTSW 14 69798323 missense probably damaging 1.00
R3953:Rhobtb2 UTSW 14 69794039 missense possibly damaging 0.49
R4655:Rhobtb2 UTSW 14 69795989 missense probably damaging 0.97
R4744:Rhobtb2 UTSW 14 69794002 missense probably damaging 1.00
R4771:Rhobtb2 UTSW 14 69797050 missense probably benign 0.20
R5648:Rhobtb2 UTSW 14 69797144 missense probably damaging 1.00
R5990:Rhobtb2 UTSW 14 69796369 missense probably damaging 1.00
R6166:Rhobtb2 UTSW 14 69798178 missense probably damaging 1.00
R6186:Rhobtb2 UTSW 14 69798244 missense probably damaging 1.00
R7448:Rhobtb2 UTSW 14 69795948 nonsense probably null
R7591:Rhobtb2 UTSW 14 69799741 missense possibly damaging 0.61
R7626:Rhobtb2 UTSW 14 69796937 missense probably damaging 1.00
R7793:Rhobtb2 UTSW 14 69796831 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- ACTGATCGCCAACTCACAGTG -3'
(R):5'- CGTGGAGATTGCCAGTGATTTC -3'

Sequencing Primer
(F):5'- TCACAGTGAGAAAAGCCATGC -3'
(R):5'- CCAGTGATTTCATGTGGGCAGC -3'
Posted On2015-10-21