Incidental Mutation 'R4712:Gfra2'
ID353325
Institutional Source Beutler Lab
Gene Symbol Gfra2
Ensembl Gene ENSMUSG00000022103
Gene Nameglial cell line derived neurotrophic factor family receptor alpha 2
SynonymsGFR alpha-2, GFR alpha 2
MMRRC Submission 041981-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.298) question?
Stock #R4712 (G1)
Quality Score225
Status Validated
Chromosome14
Chromosomal Location70890120-70979838 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 70925937 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Histidine at position 87 (L87H)
Ref Sequence ENSEMBL: ENSMUSP00000154391 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022699] [ENSMUST00000227697]
Predicted Effect probably damaging
Transcript: ENSMUST00000022699
AA Change: L220H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000022699
Gene: ENSMUSG00000022103
AA Change: L220H

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
GDNF 40 117 1.76e-15 SMART
GDNF 161 241 3.7e-23 SMART
GDNF 251 347 1.74e-28 SMART
low complexity region 381 397 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000227697
AA Change: L87H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Meta Mutation Damage Score 0.9208 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.3%
Validation Efficiency 98% (54/55)
MGI Phenotype FUNCTION: The protein encoded by this gene is part of the receptor complex that transduces glial cell-derived neurotrophic factor and neurturin signals by mediating autophosphorylation and activation of the RET receptor. Mice lacking this protein are viable and fertile but display growth retardation attributed to impaired salivary and pancreatic secretion and innervation deficits in the intestinal tract. In addition, knockout mice display neural defects including a failure to initiate outgrowth of dorsal ganglion root neurons, demonstrating a requirement in neuronal differentiation of these cells. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Oct 2014]
PHENOTYPE: Homozygous mutants have dry eyes, poor postweaning growth associated with impaired parasympathetic cholinergic innervation of lacrimal and salivary glands and of small intestine, reduced skin thickness and accelerated hair follicle regression. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210016F16Rik G A 13: 58,381,803 R332C probably benign Het
2900055J20Rik G T 18: 40,257,180 probably benign Het
A4galt G T 15: 83,227,609 N324K probably damaging Het
Ahcyl1 A G 3: 107,667,231 probably benign Het
Atrnl1 T A 19: 57,652,950 N343K probably benign Het
Batf2 C A 19: 6,171,327 Q56K probably benign Het
Cfh A T 1: 140,108,536 V691D probably damaging Het
Chst10 T C 1: 38,865,841 Y257C probably damaging Het
Dlg5 A T 14: 24,177,983 L290Q possibly damaging Het
Dnah2 T A 11: 69,516,590 T456S possibly damaging Het
Dnah6 T C 6: 73,025,012 probably null Het
Efhb T C 17: 53,451,669 K313R probably damaging Het
Eprs T A 1: 185,428,108 N1500K probably benign Het
Fbn1 T C 2: 125,341,316 T1748A probably benign Het
Gfral T A 9: 76,193,445 Y237F possibly damaging Het
Gpr137b T C 13: 13,359,389 N361D probably benign Het
Gsdmc G T 15: 63,779,537 T272N probably benign Het
Hspe1 T A 1: 55,089,110 S21R probably benign Het
Kif21a A T 15: 90,984,755 I483N probably damaging Het
Kif4-ps T C 12: 101,146,275 noncoding transcript Het
Lpp T C 16: 24,761,657 V166A possibly damaging Het
Lrp2 A C 2: 69,506,551 D1292E probably damaging Het
Manba T C 3: 135,544,814 Y401H probably damaging Het
Msh2 T G 17: 87,678,385 probably benign Het
Myef2 A T 2: 125,088,837 probably benign Het
Ncor1 T A 11: 62,344,834 Q598L probably damaging Het
Obox3 A G 7: 15,626,839 V125A probably benign Het
Olfr124 T A 17: 37,805,700 L185* probably null Het
Olfr351 A T 2: 36,860,369 probably null Het
Olfr827 G A 10: 130,210,422 T236I possibly damaging Het
Pcdh9 C A 14: 93,888,631 L34F probably damaging Het
Pcdha3 A T 18: 36,946,507 I101F probably damaging Het
Pced1b A G 15: 97,384,794 E238G probably benign Het
Pla2r1 A T 2: 60,428,650 N1131K probably damaging Het
Prmt1 A T 7: 44,981,636 S99R probably damaging Het
Rbp3 T C 14: 33,960,658 S1116P probably damaging Het
Rhobtb2 T C 14: 69,799,711 D88G probably damaging Het
Rngtt A G 4: 33,379,394 E432G probably benign Het
Sh3rf1 A G 8: 61,361,759 T451A probably benign Het
Shroom3 G T 5: 92,943,086 V1151F probably damaging Het
Siva1 T A 12: 112,646,902 D61E probably benign Het
Skor1 A C 9: 63,139,573 probably null Het
Slc20a1 A G 2: 129,199,691 probably benign Het
Slc2a7 A G 4: 150,168,469 E522G probably benign Het
Tmprss7 A T 16: 45,690,760 I85N probably damaging Het
Tpx2 T A 2: 152,885,038 D408E probably damaging Het
Ulk4 A T 9: 121,244,370 I551N probably benign Het
Zfat A T 15: 68,110,475 probably null Het
Zfp101 C A 17: 33,394,483 probably null Het
Other mutations in Gfra2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00424:Gfra2 APN 14 70968239 splice site probably benign
IGL01303:Gfra2 APN 14 70895852 missense probably benign 0.09
IGL01380:Gfra2 APN 14 70967146 splice site probably benign
IGL01528:Gfra2 APN 14 70966298 missense possibly damaging 0.95
IGL02203:Gfra2 APN 14 70967084 missense possibly damaging 0.69
IGL02270:Gfra2 APN 14 70925907 missense possibly damaging 0.78
IGL03104:Gfra2 APN 14 70968285 missense probably benign 0.00
IGL03270:Gfra2 APN 14 70925904 missense possibly damaging 0.80
H8562:Gfra2 UTSW 14 70978378 missense possibly damaging 0.94
H8786:Gfra2 UTSW 14 70978378 missense possibly damaging 0.94
R0423:Gfra2 UTSW 14 70896081 missense probably damaging 1.00
R4120:Gfra2 UTSW 14 70966275 missense probably damaging 1.00
R4172:Gfra2 UTSW 14 70896081 missense possibly damaging 0.80
R4804:Gfra2 UTSW 14 70925921 missense possibly damaging 0.76
R4902:Gfra2 UTSW 14 70967015 missense probably damaging 1.00
R5424:Gfra2 UTSW 14 70895847 missense probably damaging 1.00
R6711:Gfra2 UTSW 14 70966275 missense probably damaging 1.00
R7290:Gfra2 UTSW 14 70925940 missense probably damaging 1.00
R7322:Gfra2 UTSW 14 70968391 missense probably benign 0.00
R7814:Gfra2 UTSW 14 70895970 missense probably damaging 1.00
Z1177:Gfra2 UTSW 14 70978492 missense not run
Predicted Primers PCR Primer
(F):5'- ACATGTGTCCATTCCCTGTG -3'
(R):5'- GACCTTGTAACATAGGCCAACC -3'

Sequencing Primer
(F):5'- TTTGCCTTCCAGGGACAGG -3'
(R):5'- TTGTAACATAGGCCAACCACATGAG -3'
Posted On2015-10-21