Incidental Mutation 'R4712:Pced1b'
ID353331
Institutional Source Beutler Lab
Gene Symbol Pced1b
Ensembl Gene ENSMUSG00000044250
Gene NamePC-esterase domain containing 1B
Synonyms
MMRRC Submission 041981-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.123) question?
Stock #R4712 (G1)
Quality Score225
Status Validated
Chromosome15
Chromosomal Location97247107-97385680 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 97384794 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 238 (E238G)
Ref Sequence ENSEMBL: ENSMUSP00000154814 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000059433] [ENSMUST00000226495] [ENSMUST00000228521]
Predicted Effect probably benign
Transcript: ENSMUST00000059433
AA Change: E238G

PolyPhen 2 Score 0.025 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000055485
Gene: ENSMUSG00000044250
AA Change: E238G

DomainStartEndE-ValueType
Pfam:PC-Esterase 1 254 5.1e-53 PFAM
low complexity region 295 338 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000226495
Predicted Effect probably benign
Transcript: ENSMUST00000228521
AA Change: E238G

PolyPhen 2 Score 0.025 (Sensitivity: 0.95; Specificity: 0.81)
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.3%
Validation Efficiency 98% (54/55)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that belongs to the GDSL/SGNH-like acyl-esterase family. Members of this family are hydrolases thought to function in modification of biopolymers on the cell surface. Alternate splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jul 2013]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210016F16Rik G A 13: 58,381,803 R332C probably benign Het
2900055J20Rik G T 18: 40,257,180 probably benign Het
A4galt G T 15: 83,227,609 N324K probably damaging Het
Ahcyl1 A G 3: 107,667,231 probably benign Het
Atrnl1 T A 19: 57,652,950 N343K probably benign Het
Batf2 C A 19: 6,171,327 Q56K probably benign Het
Cfh A T 1: 140,108,536 V691D probably damaging Het
Chst10 T C 1: 38,865,841 Y257C probably damaging Het
Dlg5 A T 14: 24,177,983 L290Q possibly damaging Het
Dnah2 T A 11: 69,516,590 T456S possibly damaging Het
Dnah6 T C 6: 73,025,012 probably null Het
Efhb T C 17: 53,451,669 K313R probably damaging Het
Eprs T A 1: 185,428,108 N1500K probably benign Het
Fbn1 T C 2: 125,341,316 T1748A probably benign Het
Gfra2 T A 14: 70,925,937 L87H probably damaging Het
Gfral T A 9: 76,193,445 Y237F possibly damaging Het
Gpr137b T C 13: 13,359,389 N361D probably benign Het
Gsdmc G T 15: 63,779,537 T272N probably benign Het
Hspe1 T A 1: 55,089,110 S21R probably benign Het
Kif21a A T 15: 90,984,755 I483N probably damaging Het
Kif4-ps T C 12: 101,146,275 noncoding transcript Het
Lpp T C 16: 24,761,657 V166A possibly damaging Het
Lrp2 A C 2: 69,506,551 D1292E probably damaging Het
Manba T C 3: 135,544,814 Y401H probably damaging Het
Msh2 T G 17: 87,678,385 probably benign Het
Myef2 A T 2: 125,088,837 probably benign Het
Ncor1 T A 11: 62,344,834 Q598L probably damaging Het
Obox3 A G 7: 15,626,839 V125A probably benign Het
Olfr124 T A 17: 37,805,700 L185* probably null Het
Olfr351 A T 2: 36,860,369 probably null Het
Olfr827 G A 10: 130,210,422 T236I possibly damaging Het
Pcdh9 C A 14: 93,888,631 L34F probably damaging Het
Pcdha3 A T 18: 36,946,507 I101F probably damaging Het
Pla2r1 A T 2: 60,428,650 N1131K probably damaging Het
Prmt1 A T 7: 44,981,636 S99R probably damaging Het
Rbp3 T C 14: 33,960,658 S1116P probably damaging Het
Rhobtb2 T C 14: 69,799,711 D88G probably damaging Het
Rngtt A G 4: 33,379,394 E432G probably benign Het
Sh3rf1 A G 8: 61,361,759 T451A probably benign Het
Shroom3 G T 5: 92,943,086 V1151F probably damaging Het
Siva1 T A 12: 112,646,902 D61E probably benign Het
Skor1 A C 9: 63,139,573 probably null Het
Slc20a1 A G 2: 129,199,691 probably benign Het
Slc2a7 A G 4: 150,168,469 E522G probably benign Het
Tmprss7 A T 16: 45,690,760 I85N probably damaging Het
Tpx2 T A 2: 152,885,038 D408E probably damaging Het
Ulk4 A T 9: 121,244,370 I551N probably benign Het
Zfat A T 15: 68,110,475 probably null Het
Zfp101 C A 17: 33,394,483 probably null Het
Other mutations in Pced1b
AlleleSourceChrCoordTypePredicted EffectPPH Score
R1661:Pced1b UTSW 15 97384713 missense probably benign 0.01
R1699:Pced1b UTSW 15 97384877 missense probably damaging 1.00
R2115:Pced1b UTSW 15 97384624 nonsense probably null
R2441:Pced1b UTSW 15 97384285 missense possibly damaging 0.60
R3154:Pced1b UTSW 15 97384542 unclassified probably null
R3907:Pced1b UTSW 15 97384550 missense probably damaging 1.00
R5455:Pced1b UTSW 15 97384393 missense probably benign 0.04
R5902:Pced1b UTSW 15 97385089 nonsense probably null
R5936:Pced1b UTSW 15 97385180 missense possibly damaging 0.59
R5936:Pced1b UTSW 15 97385182 nonsense probably null
R5988:Pced1b UTSW 15 97384347 missense probably damaging 1.00
R6525:Pced1b UTSW 15 97384798 missense possibly damaging 0.91
R6868:Pced1b UTSW 15 97384341 missense probably damaging 1.00
R7128:Pced1b UTSW 15 97384598 nonsense probably null
Predicted Primers PCR Primer
(F):5'- AAGTCGTGCCTGCTAGTGTG -3'
(R):5'- GCAAACACCTGAGGTCCTAG -3'

Sequencing Primer
(F):5'- TTCCTCCCACAGAAGTGTAAGGG -3'
(R):5'- AAACACCTGAGGTCCTAGGTTGTC -3'
Posted On2015-10-21