Incidental Mutation 'R4712:Lpp'
ID353332
Institutional Source Beutler Lab
Gene Symbol Lpp
Ensembl Gene ENSMUSG00000033306
Gene NameLIM domain containing preferred translocation partner in lipoma
SynonymsB130055L10Rik, 9430020K16Rik
MMRRC Submission 041981-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.207) question?
Stock #R4712 (G1)
Quality Score225
Status Validated
Chromosome16
Chromosomal Location24393507-24992578 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 24761657 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 166 (V166A)
Ref Sequence ENSEMBL: ENSMUSP00000078005 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038053] [ENSMUST00000078988] [ENSMUST00000115314]
Predicted Effect possibly damaging
Transcript: ENSMUST00000038053
AA Change: V166A

PolyPhen 2 Score 0.936 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000036304
Gene: ENSMUSG00000033306
AA Change: V166A

DomainStartEndE-ValueType
low complexity region 41 55 N/A INTRINSIC
low complexity region 61 93 N/A INTRINSIC
coiled coil region 109 134 N/A INTRINSIC
low complexity region 174 197 N/A INTRINSIC
low complexity region 255 267 N/A INTRINSIC
low complexity region 371 386 N/A INTRINSIC
LIM 416 469 1.03e-16 SMART
LIM 476 528 1.94e-12 SMART
LIM 536 597 2.5e-15 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000078988
AA Change: V166A

PolyPhen 2 Score 0.936 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000078005
Gene: ENSMUSG00000033306
AA Change: V166A

DomainStartEndE-ValueType
low complexity region 41 55 N/A INTRINSIC
low complexity region 61 93 N/A INTRINSIC
coiled coil region 109 134 N/A INTRINSIC
low complexity region 174 197 N/A INTRINSIC
low complexity region 255 267 N/A INTRINSIC
low complexity region 371 386 N/A INTRINSIC
LIM 416 469 1.03e-16 SMART
LIM 476 528 1.94e-12 SMART
LIM 536 597 2.5e-15 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000115314
AA Change: V41A

PolyPhen 2 Score 0.933 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000110969
Gene: ENSMUSG00000033306
AA Change: V41A

DomainStartEndE-ValueType
low complexity region 49 72 N/A INTRINSIC
low complexity region 130 142 N/A INTRINSIC
low complexity region 246 261 N/A INTRINSIC
LIM 291 344 1.03e-16 SMART
LIM 351 403 1.94e-12 SMART
LIM 411 472 2.5e-15 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000231279
Meta Mutation Damage Score 0.0599 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.3%
Validation Efficiency 98% (54/55)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of a subfamily of LIM domain proteins that are characterized by an N-terminal proline-rich region and three C-terminal LIM domains. The encoded protein localizes to the cell periphery in focal adhesions and may be involved in cell-cell adhesion and cell motility. This protein also shuttles through the nucleus and may function as a transcriptional co-activator. This gene is located at the junction of certain disease-related chromosomal translocations, which result in the expression of chimeric proteins that may promote tumor growth. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2014]
PHENOTYPE: Gene disruption results in fertility problems involving females but not males. Migration and survival of MEFs are also abnormal. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210016F16Rik G A 13: 58,381,803 R332C probably benign Het
2900055J20Rik G T 18: 40,257,180 probably benign Het
A4galt G T 15: 83,227,609 N324K probably damaging Het
Ahcyl1 A G 3: 107,667,231 probably benign Het
Atrnl1 T A 19: 57,652,950 N343K probably benign Het
Batf2 C A 19: 6,171,327 Q56K probably benign Het
Cfh A T 1: 140,108,536 V691D probably damaging Het
Chst10 T C 1: 38,865,841 Y257C probably damaging Het
Dlg5 A T 14: 24,177,983 L290Q possibly damaging Het
Dnah2 T A 11: 69,516,590 T456S possibly damaging Het
Dnah6 T C 6: 73,025,012 probably null Het
Efhb T C 17: 53,451,669 K313R probably damaging Het
Eprs T A 1: 185,428,108 N1500K probably benign Het
Fbn1 T C 2: 125,341,316 T1748A probably benign Het
Gfra2 T A 14: 70,925,937 L87H probably damaging Het
Gfral T A 9: 76,193,445 Y237F possibly damaging Het
Gpr137b T C 13: 13,359,389 N361D probably benign Het
Gsdmc G T 15: 63,779,537 T272N probably benign Het
Hspe1 T A 1: 55,089,110 S21R probably benign Het
Kif21a A T 15: 90,984,755 I483N probably damaging Het
Kif4-ps T C 12: 101,146,275 noncoding transcript Het
Lrp2 A C 2: 69,506,551 D1292E probably damaging Het
Manba T C 3: 135,544,814 Y401H probably damaging Het
Msh2 T G 17: 87,678,385 probably benign Het
Myef2 A T 2: 125,088,837 probably benign Het
Ncor1 T A 11: 62,344,834 Q598L probably damaging Het
Obox3 A G 7: 15,626,839 V125A probably benign Het
Olfr124 T A 17: 37,805,700 L185* probably null Het
Olfr351 A T 2: 36,860,369 probably null Het
Olfr827 G A 10: 130,210,422 T236I possibly damaging Het
Pcdh9 C A 14: 93,888,631 L34F probably damaging Het
Pcdha3 A T 18: 36,946,507 I101F probably damaging Het
Pced1b A G 15: 97,384,794 E238G probably benign Het
Pla2r1 A T 2: 60,428,650 N1131K probably damaging Het
Prmt1 A T 7: 44,981,636 S99R probably damaging Het
Rbp3 T C 14: 33,960,658 S1116P probably damaging Het
Rhobtb2 T C 14: 69,799,711 D88G probably damaging Het
Rngtt A G 4: 33,379,394 E432G probably benign Het
Sh3rf1 A G 8: 61,361,759 T451A probably benign Het
Shroom3 G T 5: 92,943,086 V1151F probably damaging Het
Siva1 T A 12: 112,646,902 D61E probably benign Het
Skor1 A C 9: 63,139,573 probably null Het
Slc20a1 A G 2: 129,199,691 probably benign Het
Slc2a7 A G 4: 150,168,469 E522G probably benign Het
Tmprss7 A T 16: 45,690,760 I85N probably damaging Het
Tpx2 T A 2: 152,885,038 D408E probably damaging Het
Ulk4 A T 9: 121,244,370 I551N probably benign Het
Zfat A T 15: 68,110,475 probably null Het
Zfp101 C A 17: 33,394,483 probably null Het
Other mutations in Lpp
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00588:Lpp APN 16 24845188 missense probably damaging 1.00
IGL01354:Lpp APN 16 24762066 nonsense probably null
IGL02141:Lpp APN 16 24761615 missense probably damaging 0.98
IGL02182:Lpp APN 16 24762145 missense probably damaging 0.99
IGL02230:Lpp APN 16 24762145 missense probably damaging 0.99
IGL02232:Lpp APN 16 24762145 missense probably damaging 0.99
IGL02234:Lpp APN 16 24762145 missense probably damaging 0.99
IGL02236:Lpp APN 16 24762145 missense probably damaging 0.99
IGL02371:Lpp APN 16 24761611 missense probably damaging 0.96
IGL03265:Lpp APN 16 24761987 missense probably damaging 1.00
PIT4585001:Lpp UTSW 16 24761947 missense probably benign 0.23
R0047:Lpp UTSW 16 24661800 splice site probably benign
R0047:Lpp UTSW 16 24661800 splice site probably benign
R0092:Lpp UTSW 16 24761602 missense probably benign 0.01
R0385:Lpp UTSW 16 24761837 missense probably damaging 1.00
R0389:Lpp UTSW 16 24608241 missense probably damaging 1.00
R0504:Lpp UTSW 16 24971970 missense probably damaging 1.00
R0798:Lpp UTSW 16 24971872 nonsense probably null
R1199:Lpp UTSW 16 24681860 missense probably damaging 1.00
R1581:Lpp UTSW 16 24681841 nonsense probably null
R1755:Lpp UTSW 16 24845124 missense probably benign
R1848:Lpp UTSW 16 24761655 missense probably damaging 1.00
R1980:Lpp UTSW 16 24661701 missense probably damaging 1.00
R3432:Lpp UTSW 16 24889886 missense probably benign 0.04
R3755:Lpp UTSW 16 24845161 missense probably benign 0.00
R4078:Lpp UTSW 16 24681861 missense probably damaging 1.00
R4214:Lpp UTSW 16 24762054 nonsense probably null
R4806:Lpp UTSW 16 24661680 missense probably damaging 0.97
R4968:Lpp UTSW 16 24979314 missense probably damaging 1.00
R5047:Lpp UTSW 16 24971846 missense probably damaging 1.00
R5371:Lpp UTSW 16 24889804 missense probably damaging 1.00
R5536:Lpp UTSW 16 24845206 missense possibly damaging 0.54
R5875:Lpp UTSW 16 24608309 missense probably benign 0.10
R7285:Lpp UTSW 16 24977279 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AACTTCGTAAGGGAAGGATCTTC -3'
(R):5'- AGCCATGTAATGTGGGCTGG -3'

Sequencing Primer
(F):5'- ATTAACCATACTCCCTATCTAC -3'
(R):5'- TCACTTGCACATTAAAGGTGGGC -3'
Posted On2015-10-21