Mutagenetix > Incidental Mutations

Incidental Mutation 'R4712:Atrnl1'

353339

Institutional Source

Beutler Lab

Gene Symbol

Atrnl1

Ensembl Gene

ENSMUSG00000054843

Gene Name

attractin like 1

Synonyms

Alp

MMRRC Submission

041981-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.166) question?

Stock #

R4712 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

57611034-58133338 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 57652950 bp

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Lysine at position 343 (N343K)

Ref Sequence

ENSEMBL: ENSMUSP00000076514 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000077282]

Predicted Effect

probably benign
Transcript: ENSMUST00000077282
AA Change: N343K

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)

SMART Domains

Protein: ENSMUSP00000076514
Gene: ENSMUSG00000054843
AA Change: N343K

Domain	Start	End	E-Value	Type
low complexity region	25	32	N/A	INTRINSIC
EGF	61	90	5.71e-1	SMART
CUB	92	208	1.43e-11	SMART
EGF	209	244	1.95e1	SMART
Pfam:EGF_2	248	279	5.8e-7	PFAM
Pfam:Kelch_5	350	391	2.1e-9	PFAM
Pfam:Kelch_6	354	401	5.8e-8	PFAM
Pfam:Kelch_4	465	517	4.3e-7	PFAM
Pfam:Kelch_1	519	573	2.7e-6	PFAM
PSI	613	656	3.38e-1	SMART
PSI	665	708	2e-3	SMART
PSI	714	759	1.72e-2	SMART
CLECT	747	872	2.86e-20	SMART
PSI	888	938	6.26e-5	SMART
PSI	941	1011	1.73e-7	SMART
EGF_Lam	1013	1056	1.07e-5	SMART
low complexity region	1157	1173	N/A	INTRINSIC
transmembrane domain	1229	1251	N/A	INTRINSIC
low complexity region	1261	1272	N/A	INTRINSIC
low complexity region	1326	1339	N/A	INTRINSIC

Meta Mutation Damage Score

0.0864

Coding Region Coverage

1x: 99.1%
3x: 98.5%
10x: 96.8%
20x: 94.3%

Validation Efficiency

98% (54/55)

MGI Phenotype

PHENOTYPE: Mice homozygous for a null allele exhibit normal coat coloring and normal brain morphology. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 49 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2210016F16Rik	G	A	13: 58,381,803	R332C	probably benign	Het
2900055J20Rik	G	T	18: 40,257,180		probably benign	Het
A4galt	G	T	15: 83,227,609	N324K	probably damaging	Het
Ahcyl1	A	G	3: 107,667,231		probably benign	Het
Batf2	C	A	19: 6,171,327	Q56K	probably benign	Het
Cfh	A	T	1: 140,108,536	V691D	probably damaging	Het
Chst10	T	C	1: 38,865,841	Y257C	probably damaging	Het
Dlg5	A	T	14: 24,177,983	L290Q	possibly damaging	Het
Dnah2	T	A	11: 69,516,590	T456S	possibly damaging	Het
Dnah6	T	C	6: 73,025,012		probably null	Het
Efhb	T	C	17: 53,451,669	K313R	probably damaging	Het
Eprs	T	A	1: 185,428,108	N1500K	probably benign	Het
Fbn1	T	C	2: 125,341,316	T1748A	probably benign	Het
Gfra2	T	A	14: 70,925,937	L87H	probably damaging	Het
Gfral	T	A	9: 76,193,445	Y237F	possibly damaging	Het
Gpr137b	T	C	13: 13,359,389	N361D	probably benign	Het
Gsdmc	G	T	15: 63,779,537	T272N	probably benign	Het
Hspe1	T	A	1: 55,089,110	S21R	probably benign	Het
Kif21a	A	T	15: 90,984,755	I483N	probably damaging	Het
Kif4-ps	T	C	12: 101,146,275		noncoding transcript	Het
Lpp	T	C	16: 24,761,657	V166A	possibly damaging	Het
Lrp2	A	C	2: 69,506,551	D1292E	probably damaging	Het
Manba	T	C	3: 135,544,814	Y401H	probably damaging	Het
Msh2	T	G	17: 87,678,385		probably benign	Het
Myef2	A	T	2: 125,088,837		probably benign	Het
Ncor1	T	A	11: 62,344,834	Q598L	probably damaging	Het
Obox3	A	G	7: 15,626,839	V125A	probably benign	Het
Olfr124	T	A	17: 37,805,700	L185*	probably null	Het
Olfr351	A	T	2: 36,860,369		probably null	Het
Olfr827	G	A	10: 130,210,422	T236I	possibly damaging	Het
Pcdh9	C	A	14: 93,888,631	L34F	probably damaging	Het
Pcdha3	A	T	18: 36,946,507	I101F	probably damaging	Het
Pced1b	A	G	15: 97,384,794	E238G	probably benign	Het
Pla2r1	A	T	2: 60,428,650	N1131K	probably damaging	Het
Prmt1	A	T	7: 44,981,636	S99R	probably damaging	Het
Rbp3	T	C	14: 33,960,658	S1116P	probably damaging	Het
Rhobtb2	T	C	14: 69,799,711	D88G	probably damaging	Het
Rngtt	A	G	4: 33,379,394	E432G	probably benign	Het
Sh3rf1	A	G	8: 61,361,759	T451A	probably benign	Het
Shroom3	G	T	5: 92,943,086	V1151F	probably damaging	Het
Siva1	T	A	12: 112,646,902	D61E	probably benign	Het
Skor1	A	C	9: 63,139,573		probably null	Het
Slc20a1	A	G	2: 129,199,691		probably benign	Het
Slc2a7	A	G	4: 150,168,469	E522G	probably benign	Het
Tmprss7	A	T	16: 45,690,760	I85N	probably damaging	Het
Tpx2	T	A	2: 152,885,038	D408E	probably damaging	Het
Ulk4	A	T	9: 121,244,370	I551N	probably benign	Het
Zfat	A	T	15: 68,110,475		probably null	Het
Zfp101	C	A	17: 33,394,483		probably null	Het

Other mutations in Atrnl1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00323:Atrnl1	APN	19	57691817	missense	probably benign	0.02
IGL00707:Atrnl1	APN	19	57673265	missense	probably damaging	0.96
IGL00921:Atrnl1	APN	19	57702153	missense	probably damaging	1.00
IGL01410:Atrnl1	APN	19	58131104	missense	probably damaging	1.00
IGL01468:Atrnl1	APN	19	57699712	missense	probably benign	0.02
IGL01756:Atrnl1	APN	19	57652948	missense	probably benign
IGL01971:Atrnl1	APN	19	57753283	missense	probably damaging	1.00
IGL02019:Atrnl1	APN	19	57691763	splice site	probably benign
IGL02580:Atrnl1	APN	19	57714576	splice site	probably benign
IGL02649:Atrnl1	APN	19	57650441	splice site	probably benign
IGL02676:Atrnl1	APN	19	57691884	missense	probably damaging	1.00
IGL03276:Atrnl1	APN	19	57652927	missense	probably damaging	0.99
IGL03379:Atrnl1	APN	19	57642541	missense	probably benign	0.02
Magnetogorsk	UTSW	19	57630306	missense	probably damaging	1.00
polar	UTSW	19	57652950	missense	probably benign	0.00
PIT4812001:Atrnl1	UTSW	19	57731623	missense	probably benign	0.08
R0109:Atrnl1	UTSW	19	57755517	missense	possibly damaging	0.78
R0308:Atrnl1	UTSW	19	57753288	missense	probably benign	0.04
R0394:Atrnl1	UTSW	19	57673176	missense	probably benign	0.10
R0734:Atrnl1	UTSW	19	57654861	missense	probably damaging	1.00
R0811:Atrnl1	UTSW	19	57673141	missense	probably benign	0.07
R0812:Atrnl1	UTSW	19	57673141	missense	probably benign	0.07
R1183:Atrnl1	UTSW	19	57650293	missense	probably damaging	0.97
R1213:Atrnl1	UTSW	19	57638462	missense	probably benign	0.25
R1344:Atrnl1	UTSW	19	57935705	critical splice donor site	probably null
R1418:Atrnl1	UTSW	19	57935705	critical splice donor site	probably null
R1707:Atrnl1	UTSW	19	57686737	missense	probably benign	0.00
R1748:Atrnl1	UTSW	19	57714702	missense	probably damaging	0.99
R2051:Atrnl1	UTSW	19	57691849	missense	probably benign	0.01
R2113:Atrnl1	UTSW	19	57755616	nonsense	probably null
R2130:Atrnl1	UTSW	19	57654994	missense	probably damaging	1.00
R3710:Atrnl1	UTSW	19	57657114	missense	probably damaging	1.00
R3916:Atrnl1	UTSW	19	57935652	missense	possibly damaging	0.82
R4524:Atrnl1	UTSW	19	57630306	missense	probably damaging	1.00
R4707:Atrnl1	UTSW	19	57629158	missense	probably damaging	0.97
R4784:Atrnl1	UTSW	19	57629158	missense	probably damaging	0.97
R4785:Atrnl1	UTSW	19	57629158	missense	probably damaging	0.97
R4798:Atrnl1	UTSW	19	58042361	missense	probably benign
R5172:Atrnl1	UTSW	19	57685513	nonsense	probably null
R5226:Atrnl1	UTSW	19	57650335	missense	probably benign
R5289:Atrnl1	UTSW	19	57657082	missense	probably damaging	1.00
R5372:Atrnl1	UTSW	19	57755536	missense	probably benign
R5737:Atrnl1	UTSW	19	57777888	missense	possibly damaging	0.84
R5782:Atrnl1	UTSW	19	57753286	missense	possibly damaging	0.95
R5826:Atrnl1	UTSW	19	57630292	nonsense	probably null
R6169:Atrnl1	UTSW	19	57642463	missense	probably benign	0.00
R6242:Atrnl1	UTSW	19	57642478	missense	probably benign	0.02
R6342:Atrnl1	UTSW	19	57638510	missense	probably damaging	1.00
R6372:Atrnl1	UTSW	19	57650332	missense	probably benign	0.01
R6811:Atrnl1	UTSW	19	57654961	missense	probably damaging	0.98
R6897:Atrnl1	UTSW	19	58042368	missense	probably benign	0.01
R7024:Atrnl1	UTSW	19	57638450	critical splice acceptor site	probably null
R7085:Atrnl1	UTSW	19	57691857	missense	probably damaging	1.00
R7144:Atrnl1	UTSW	19	58042352	missense	probably damaging	1.00
R7259:Atrnl1	UTSW	19	57935606	nonsense	probably null
R7289:Atrnl1	UTSW	19	57650414	missense	probably benign	0.13
R7310:Atrnl1	UTSW	19	57642424	missense	possibly damaging	0.69
R7372:Atrnl1	UTSW	19	57935646	missense	possibly damaging	0.47
R7432:Atrnl1	UTSW	19	57755524	missense	probably damaging	1.00
R7478:Atrnl1	UTSW	19	57696312	missense	possibly damaging	0.89
R7556:Atrnl1	UTSW	19	57654846	missense	probably benign
R7567:Atrnl1	UTSW	19	57699523	missense	probably damaging	0.98
R7608:Atrnl1	UTSW	19	57714687	missense	probably damaging	1.00
R7632:Atrnl1	UTSW	19	57630306	missense	probably damaging	1.00
R7655:Atrnl1	UTSW	19	57611379	nonsense	probably null
R7656:Atrnl1	UTSW	19	57611379	nonsense	probably null
R7718:Atrnl1	UTSW	19	57740183	nonsense	probably null
R7721:Atrnl1	UTSW	19	57696331	missense	probably benign	0.00
R7726:Atrnl1	UTSW	19	57702072	missense	probably damaging	1.00
R7733:Atrnl1	UTSW	19	57701988	missense	probably benign	0.00
R7774:Atrnl1	UTSW	19	57699671	missense	probably damaging	1.00
R8010:Atrnl1	UTSW	19	57682446	missense	probably benign	0.14
R8119:Atrnl1	UTSW	19	57642463	missense	probably benign	0.00
RF021:Atrnl1	UTSW	19	57642473	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- GGTATTTCTCAACTGAAGCTTCATC -3'
(R):5'- TTATAGAATGTCGGTCTAGTGGAC -3'

Sequencing Primer
(F):5'- TTCTCAACTGAAGCTTCATCAACAG -3'
(R):5'- AACCCTGAGTCTCTCTGGTC -3'

Posted On

2015-10-21