Incidental Mutation 'R0271:Olfr1491'
ID35334
Institutional Source Beutler Lab
Gene Symbol Olfr1491
Ensembl Gene ENSMUSG00000051156
Gene Nameolfactory receptor 1491
SynonymsGA_x6K02T2RE5P-4037809-4038768, MOR266-8
MMRRC Submission 038497-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0271 (G1)
Quality Score197
Status Validated
Chromosome19
Chromosomal Location13697268-13706127 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 13705135 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Serine at position 103 (T103S)
Ref Sequence ENSEMBL: ENSMUSP00000149884 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000052737] [ENSMUST00000214007] [ENSMUST00000215493] [ENSMUST00000216366] [ENSMUST00000216377] [ENSMUST00000216622]
Predicted Effect probably benign
Transcript: ENSMUST00000052737
AA Change: T103S

PolyPhen 2 Score 0.033 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000057902
Gene: ENSMUSG00000051156
AA Change: T103S

DomainStartEndE-ValueType
Pfam:7tm_4 35 314 3.3e-52 PFAM
Pfam:7tm_1 45 295 5.9e-24 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000214007
AA Change: T103S

PolyPhen 2 Score 0.033 (Sensitivity: 0.95; Specificity: 0.82)
Predicted Effect probably benign
Transcript: ENSMUST00000215493
AA Change: T103S

PolyPhen 2 Score 0.033 (Sensitivity: 0.95; Specificity: 0.82)
Predicted Effect probably benign
Transcript: ENSMUST00000216366
AA Change: T103S

PolyPhen 2 Score 0.033 (Sensitivity: 0.95; Specificity: 0.82)
Predicted Effect probably benign
Transcript: ENSMUST00000216377
AA Change: T103S

PolyPhen 2 Score 0.033 (Sensitivity: 0.95; Specificity: 0.82)
Predicted Effect probably benign
Transcript: ENSMUST00000216622
AA Change: T103S

PolyPhen 2 Score 0.033 (Sensitivity: 0.95; Specificity: 0.82)
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 98.5%
  • 3x: 97.4%
  • 10x: 95.2%
  • 20x: 90.6%
Validation Efficiency 100% (65/65)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810403A07Rik T C 3: 88,686,329 probably benign Het
4930544D05Rik A G 11: 70,616,648 Q173R possibly damaging Het
Ampd2 C T 3: 108,086,716 probably benign Het
Ankrd17 T C 5: 90,254,799 S1467G possibly damaging Het
Arhgap31 T G 16: 38,602,510 S1065R possibly damaging Het
Arhgef19 G T 4: 141,250,607 M542I probably benign Het
C7 T C 15: 5,015,380 D392G possibly damaging Het
Ccdc138 G A 10: 58,575,823 C671Y probably damaging Het
Cdh8 A G 8: 99,111,715 S498P possibly damaging Het
Cpb2 T A 14: 75,257,709 probably null Het
Cwc22 A C 2: 77,920,858 N389K probably benign Het
Dgkb T A 12: 38,228,026 L550Q probably damaging Het
Dip2c A G 13: 9,615,775 R950G probably damaging Het
Eml6 A G 11: 29,848,949 V437A possibly damaging Het
Fanca T C 8: 123,272,441 probably benign Het
Fgd2 C G 17: 29,367,008 L189V possibly damaging Het
Foxred2 A C 15: 77,943,390 S590A possibly damaging Het
Gm1110 A G 9: 26,920,666 F63S probably damaging Het
Gm14496 A T 2: 181,995,954 M274L probably benign Het
Gm7008 T A 12: 40,223,560 probably benign Het
Gm9922 T A 14: 101,729,553 probably benign Het
Gtf3c3 A T 1: 54,428,812 M222K possibly damaging Het
Hspa1b A G 17: 34,958,832 V59A probably benign Het
Impg1 T C 9: 80,386,879 probably benign Het
Lpcat4 T A 2: 112,243,245 probably null Het
Mipol1 T C 12: 57,460,954 probably benign Het
Mrpl37 C A 4: 107,066,461 R112L possibly damaging Het
Myo18b T C 5: 112,809,685 N1471D possibly damaging Het
Nes G A 3: 87,978,642 E1359K possibly damaging Het
Nipbl A T 15: 8,361,737 V251E possibly damaging Het
Nlrp1b T C 11: 71,161,765 I946V possibly damaging Het
Obscn T G 11: 59,056,742 probably benign Het
Olfr1024 A T 2: 85,904,289 M255K possibly damaging Het
Olfr1239 T A 2: 89,418,158 Y85F probably benign Het
Olfr635 T A 7: 103,979,630 I146K possibly damaging Het
Pck2 T C 14: 55,544,584 probably null Het
Pcsk9 A G 4: 106,449,049 probably benign Het
Phyhd1 A T 2: 30,269,822 Q56L probably benign Het
Plxnc1 C T 10: 94,837,918 G1001S probably null Het
Prss52 T C 14: 64,113,678 V304A probably benign Het
Prss55 C T 14: 64,075,607 G276D probably benign Het
Pzp A T 6: 128,519,514 Y252N probably damaging Het
Rad1 T C 15: 10,490,457 probably null Het
Ripply3 A T 16: 94,335,757 E92D possibly damaging Het
Rpp30 T A 19: 36,104,403 D255E probably benign Het
Rsad1 T C 11: 94,548,464 probably benign Het
Serpini2 A G 3: 75,246,578 M358T probably damaging Het
Slc35a1 T A 4: 34,664,125 E331V probably benign Het
Slc38a7 A G 8: 95,845,878 F179L probably damaging Het
Stmn4 C T 14: 66,356,283 Q42* probably null Het
Sytl2 T C 7: 90,403,020 probably benign Het
Tab2 G A 10: 7,919,158 A520V probably benign Het
Tcp10a A G 17: 7,331,156 I162M probably benign Het
Tmprss13 A G 9: 45,333,688 probably benign Het
Tnfrsf14 A G 4: 154,926,597 probably null Het
Tpx2 A G 2: 152,867,367 probably benign Het
Vmn2r105 T A 17: 20,234,703 N57I probably damaging Het
Wars C T 12: 108,875,193 V220I probably benign Het
Washc1 T A 17: 66,116,719 D212E possibly damaging Het
Wdr17 C T 8: 54,693,096 A90T possibly damaging Het
Wdr43 A G 17: 71,626,825 D139G probably benign Het
Zfp235 A T 7: 24,137,131 H34L possibly damaging Het
Zkscan16 G A 4: 58,952,391 V230I probably benign Het
Other mutations in Olfr1491
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00958:Olfr1491 APN 19 13705732 missense probably benign 0.05
IGL02713:Olfr1491 APN 19 13705189 missense possibly damaging 0.78
IGL02822:Olfr1491 APN 19 13705655 missense probably benign 0.13
R0083:Olfr1491 UTSW 19 13705678 missense probably damaging 0.99
R0108:Olfr1491 UTSW 19 13705678 missense probably damaging 0.99
R1364:Olfr1491 UTSW 19 13705445 missense probably benign 0.11
R1538:Olfr1491 UTSW 19 13705496 missense probably damaging 1.00
R1575:Olfr1491 UTSW 19 13705525 missense probably benign 0.00
R1579:Olfr1491 UTSW 19 13705202 missense probably damaging 1.00
R2179:Olfr1491 UTSW 19 13705394 missense probably damaging 0.98
R4393:Olfr1491 UTSW 19 13705190 missense possibly damaging 0.50
R5837:Olfr1491 UTSW 19 13704960 nonsense probably null
R6001:Olfr1491 UTSW 19 13705060 missense probably damaging 0.98
R8064:Olfr1491 UTSW 19 13705022 missense not run
Z1176:Olfr1491 UTSW 19 13705203 missense not run
Predicted Primers PCR Primer
(F):5'- TCTGTGGCAACACTGCCATCATC -3'
(R):5'- CACATGAATGTCAGCACAGGCTAGG -3'

Sequencing Primer
(F):5'- ATGCTACACCACAGATGTGG -3'
(R):5'- TTTCCAGGTAATGTCCACAGAAGG -3'
Posted On2013-05-09