Incidental Mutation 'R4713:Knl1'
ID353344
Institutional Source Beutler Lab
Gene Symbol Knl1
Ensembl Gene ENSMUSG00000027326
Gene Namekinetochore scaffold 1
Synonyms2310043D08Rik, 5730505K17Rik
MMRRC Submission 041601-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4713 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location119047119-119105501 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 119069137 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Stop codon at position 440 (K440*)
Ref Sequence ENSEMBL: ENSMUSP00000118646 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028799] [ENSMUST00000028802] [ENSMUST00000099542] [ENSMUST00000152380] [ENSMUST00000153300]
Predicted Effect probably null
Transcript: ENSMUST00000028799
AA Change: K440*
SMART Domains Protein: ENSMUSP00000028799
Gene: ENSMUSG00000027326
AA Change: K440*

DomainStartEndE-ValueType
low complexity region 49 58 N/A INTRINSIC
PDB:4A1G|H 126 175 1e-13 PDB
low complexity region 426 433 N/A INTRINSIC
low complexity region 883 894 N/A INTRINSIC
low complexity region 1148 1159 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000028802
AA Change: K440*
SMART Domains Protein: ENSMUSP00000028802
Gene: ENSMUSG00000027326
AA Change: K440*

DomainStartEndE-ValueType
low complexity region 49 58 N/A INTRINSIC
internal_repeat_1 98 304 1.57e-6 PROSPERO
low complexity region 426 433 N/A INTRINSIC
internal_repeat_1 610 824 1.57e-6 PROSPERO
low complexity region 883 894 N/A INTRINSIC
low complexity region 1148 1159 N/A INTRINSIC
low complexity region 1621 1644 N/A INTRINSIC
coiled coil region 1724 1755 N/A INTRINSIC
low complexity region 1836 1850 N/A INTRINSIC
low complexity region 1864 1878 N/A INTRINSIC
PDB:4NF9|B 1899 2119 1e-115 PDB
Predicted Effect probably null
Transcript: ENSMUST00000099542
AA Change: K440*
SMART Domains Protein: ENSMUSP00000097140
Gene: ENSMUSG00000027326
AA Change: K440*

DomainStartEndE-ValueType
low complexity region 49 58 N/A INTRINSIC
internal_repeat_1 98 304 1.57e-6 PROSPERO
low complexity region 426 433 N/A INTRINSIC
internal_repeat_1 610 824 1.57e-6 PROSPERO
low complexity region 883 894 N/A INTRINSIC
low complexity region 1148 1159 N/A INTRINSIC
low complexity region 1621 1644 N/A INTRINSIC
coiled coil region 1724 1755 N/A INTRINSIC
low complexity region 1836 1850 N/A INTRINSIC
low complexity region 1864 1878 N/A INTRINSIC
PDB:4NF9|B 1899 2119 1e-115 PDB
Predicted Effect probably null
Transcript: ENSMUST00000152380
AA Change: K440*
SMART Domains Protein: ENSMUSP00000118646
Gene: ENSMUSG00000027326
AA Change: K440*

DomainStartEndE-ValueType
low complexity region 49 58 N/A INTRINSIC
PDB:4A1G|H 126 175 3e-14 PDB
low complexity region 426 433 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000153300
SMART Domains Protein: ENSMUSP00000120905
Gene: ENSMUSG00000027326

DomainStartEndE-ValueType
low complexity region 49 58 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.7%
  • 20x: 94.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a component of the multiprotein assembly that is required for creation of kinetochore-microtubule attachments and chromosome segregation. The encoded protein functions as a scaffold for proteins that influence the spindle assembly checkpoint during the eukaryotic cell cycle and it interacts with at least five different kinetochore proteins and two checkpoint kinases. In adults, this gene is predominantly expressed in normal testes, various cancer cell lines and primary tumors from other tissues and is ubiquitously expressed in fetal tissues. This gene was originally identified as a fusion partner with the mixed-lineage leukemia (MLL) gene in t(11;15)(q23;q14). Mutations in this gene cause autosomal recessive primary microcephaly-4 (MCPH4). Alternative splicing results in multiple transcript variants encoding different isoforms. Additional splice variants have been described but their biological validity has not been confirmed. [provided by RefSeq, Jan 2013]
PHENOTYPE: Mice homozygous for a transgenic gene disruption exhibit embryonic lethality at E6. Mice homozygous for an ENU-induced allele exhibit possible embryonic lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrb3 G T 1: 25,547,532 T360K probably damaging Het
AW551984 T C 9: 39,597,153 K356E probably benign Het
Bpifb2 T A 2: 153,881,193 V123E probably damaging Het
Cacna1a T G 8: 84,549,514 F532V probably damaging Het
Cct8 C A 16: 87,487,688 E204* probably null Het
Cd163 T A 6: 124,317,618 probably null Het
Cep152 C A 2: 125,587,948 A685S possibly damaging Het
Chdh A G 14: 30,036,841 D581G probably benign Het
Cnpy3 A C 17: 46,747,465 Y77* probably null Het
Col5a3 T C 9: 20,793,574 E762G unknown Het
Creb3 A G 4: 43,563,247 T115A probably benign Het
Dlat G T 9: 50,644,481 A412E probably benign Het
Dnah2 T C 11: 69,476,688 N1789S probably damaging Het
Dzank1 C T 2: 144,491,804 E370K probably benign Het
Eif3m A T 2: 105,006,839 probably null Het
Gimap8 A T 6: 48,658,986 M562L probably benign Het
Gm15448 G T 7: 3,822,681 Y396* probably null Het
Gprc6a T A 10: 51,631,457 probably benign Het
Gsr T G 8: 33,680,319 probably null Het
Gstcd A G 3: 132,983,099 V630A probably damaging Het
Hip1r T C 5: 123,989,980 I116T probably benign Het
Hivep3 A G 4: 120,131,803 E1817G probably damaging Het
Inpp5f A C 7: 128,663,725 T135P probably damaging Het
Ism2 A G 12: 87,285,027 silent Het
Itga11 A G 9: 62,765,788 D784G probably damaging Het
Itpr2 A G 6: 146,373,173 F837S probably damaging Het
Itpr2 T C 6: 146,396,958 E10G probably damaging Het
Lonp2 T C 8: 86,713,315 S648P probably damaging Het
Lrba T C 3: 86,359,868 S1622P probably benign Het
Lrp2 G T 2: 69,487,966 A2047D probably damaging Het
Mcm3 G A 1: 20,803,577 T773I probably benign Het
Mfsd7a T C 5: 108,442,079 T486A probably damaging Het
Mki67 A G 7: 135,695,469 V2612A probably benign Het
Mnx1 C A 5: 29,478,131 G49W probably damaging Het
Muc5b T A 7: 141,849,079 Y673* probably null Het
Myo15 A G 11: 60,479,930 H1172R probably benign Het
Myo1g T C 11: 6,516,080 K363R probably null Het
Ncoa4 T A 14: 32,176,641 C473S probably benign Het
Nefh T C 11: 4,939,656 T988A unknown Het
Nwd2 T A 5: 63,804,460 D462E probably benign Het
Olfr332 T C 11: 58,490,087 T223A probably benign Het
Plec T C 15: 76,181,067 E1466G unknown Het
Prl3d2 G T 13: 27,122,396 M35I probably benign Het
Reln T A 5: 22,152,463 I202F probably benign Het
Rhot1 T A 11: 80,225,602 D78E probably benign Het
Rsph3b T C 17: 6,905,129 probably null Het
Scn10a C T 9: 119,609,651 M1717I probably damaging Het
Sema6a T A 18: 47,249,296 H728L possibly damaging Het
Slc26a3 G T 12: 31,457,080 A345S possibly damaging Het
Slc35d2 A G 13: 64,099,283 V261A possibly damaging Het
Ssmem1 A G 6: 30,519,514 D66G probably damaging Het
Sult2a8 A T 7: 14,425,477 N72K probably benign Het
Tbx10 T C 19: 3,996,921 L108P probably damaging Het
Tex14 T C 11: 87,536,865 S48P probably damaging Het
Tmie A G 9: 110,867,528 L95P probably damaging Het
Tom1l2 C G 11: 60,270,433 R84P probably damaging Het
Trpm3 T A 19: 22,889,435 D543E possibly damaging Het
Vipr2 A C 12: 116,080,131 R49S probably benign Het
Vps8 A T 16: 21,442,439 S110C probably damaging Het
Zfp791 T A 8: 85,110,968 N89I probably damaging Het
Other mutations in Knl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00272:Knl1 APN 2 119064083 missense probably damaging 0.96
IGL00582:Knl1 APN 2 119102499 missense probably benign 0.19
IGL00666:Knl1 APN 2 119070464 missense probably damaging 0.96
IGL01062:Knl1 APN 2 119076980 missense probably benign 0.33
IGL01395:Knl1 APN 2 119071566 missense probably damaging 0.96
IGL01604:Knl1 APN 2 119070001 missense probably damaging 1.00
IGL01996:Knl1 APN 2 119104061 missense probably damaging 1.00
IGL02086:Knl1 APN 2 119100774 missense probably benign 0.40
IGL02105:Knl1 APN 2 119071808 missense probably benign
IGL02106:Knl1 APN 2 119072008 missense possibly damaging 0.89
IGL02201:Knl1 APN 2 119069152 missense probably benign 0.01
IGL02252:Knl1 APN 2 119072540 missense probably damaging 1.00
IGL02414:Knl1 APN 2 119070323 missense possibly damaging 0.83
IGL02655:Knl1 APN 2 119070992 missense possibly damaging 0.62
IGL02682:Knl1 APN 2 119077969 missense possibly damaging 0.86
IGL02710:Knl1 APN 2 119070930 missense probably damaging 0.99
IGL02877:Knl1 APN 2 119088831 missense probably benign 0.08
IGL03100:Knl1 APN 2 119100770 missense probably damaging 0.99
IGL03210:Knl1 APN 2 119070617 missense probably benign 0.02
IGL03138:Knl1 UTSW 2 119072359 missense probably damaging 0.96
R0023:Knl1 UTSW 2 119102549 missense possibly damaging 0.73
R0064:Knl1 UTSW 2 119076243 missense probably benign 0.00
R0064:Knl1 UTSW 2 119076243 missense probably benign 0.00
R0078:Knl1 UTSW 2 119069892 missense probably benign 0.16
R0178:Knl1 UTSW 2 119058405 splice site probably benign
R0295:Knl1 UTSW 2 119088839 missense probably damaging 1.00
R0433:Knl1 UTSW 2 119104061 missense probably damaging 0.96
R0453:Knl1 UTSW 2 119068388 missense probably damaging 1.00
R0569:Knl1 UTSW 2 119097435 missense possibly damaging 0.95
R0827:Knl1 UTSW 2 119088901 splice site probably benign
R0920:Knl1 UTSW 2 119069828 missense probably benign 0.00
R1120:Knl1 UTSW 2 119062375 missense probably damaging 0.99
R1155:Knl1 UTSW 2 119071154 missense possibly damaging 0.90
R1204:Knl1 UTSW 2 119071189 missense probably benign 0.00
R1241:Knl1 UTSW 2 119072573 missense probably benign 0.03
R1387:Knl1 UTSW 2 119070730 missense possibly damaging 0.93
R1448:Knl1 UTSW 2 119068307 missense probably damaging 1.00
R1469:Knl1 UTSW 2 119071346 missense possibly damaging 0.73
R1469:Knl1 UTSW 2 119071346 missense possibly damaging 0.73
R1719:Knl1 UTSW 2 119071738 missense probably benign 0.01
R1721:Knl1 UTSW 2 119076334 missense probably damaging 1.00
R2128:Knl1 UTSW 2 119071819 missense possibly damaging 0.79
R2170:Knl1 UTSW 2 119087594 critical splice donor site probably null
R2227:Knl1 UTSW 2 119072000 missense probably damaging 0.97
R2246:Knl1 UTSW 2 119072227 missense probably damaging 1.00
R2275:Knl1 UTSW 2 119072281 missense probably damaging 0.99
R2508:Knl1 UTSW 2 119058368 nonsense probably null
R3115:Knl1 UTSW 2 119070391 missense possibly damaging 0.53
R3122:Knl1 UTSW 2 119068944 missense probably benign 0.32
R3431:Knl1 UTSW 2 119062362 missense probably damaging 1.00
R3755:Knl1 UTSW 2 119102579 missense probably damaging 1.00
R4461:Knl1 UTSW 2 119059599 missense probably benign 0.00
R4600:Knl1 UTSW 2 119070544 missense possibly damaging 0.90
R4758:Knl1 UTSW 2 119071732 frame shift probably null
R4762:Knl1 UTSW 2 119071936 missense probably benign 0.01
R4869:Knl1 UTSW 2 119072351 missense possibly damaging 0.73
R4870:Knl1 UTSW 2 119081513 missense probably benign 0.22
R4935:Knl1 UTSW 2 119068957 missense possibly damaging 0.50
R5167:Knl1 UTSW 2 119070031 missense probably damaging 1.00
R5184:Knl1 UTSW 2 119069176 missense probably damaging 1.00
R5293:Knl1 UTSW 2 119069695 missense probably damaging 0.99
R5326:Knl1 UTSW 2 119068348 missense possibly damaging 0.66
R5331:Knl1 UTSW 2 119070255 missense possibly damaging 0.92
R5353:Knl1 UTSW 2 119070983 missense probably benign 0.01
R5493:Knl1 UTSW 2 119068730 missense probably damaging 0.98
R5542:Knl1 UTSW 2 119068348 missense possibly damaging 0.66
R5632:Knl1 UTSW 2 119070352 missense probably damaging 1.00
R5650:Knl1 UTSW 2 119081550 nonsense probably null
R5854:Knl1 UTSW 2 119070403 missense probably benign 0.02
R5979:Knl1 UTSW 2 119069360 missense possibly damaging 0.83
R6086:Knl1 UTSW 2 119094068 missense probably damaging 1.00
R6283:Knl1 UTSW 2 119070286 missense probably damaging 1.00
R6285:Knl1 UTSW 2 119071941 missense probably damaging 1.00
R6313:Knl1 UTSW 2 119069318 missense probably damaging 1.00
R6419:Knl1 UTSW 2 119069003 missense probably benign 0.02
R6608:Knl1 UTSW 2 119086612 missense probably damaging 0.99
R6881:Knl1 UTSW 2 119095184 missense possibly damaging 0.67
R7161:Knl1 UTSW 2 119070785 missense possibly damaging 0.79
R7206:Knl1 UTSW 2 119069299 missense probably benign 0.35
R7270:Knl1 UTSW 2 119102522 missense possibly damaging 0.53
R7276:Knl1 UTSW 2 119071686 missense probably damaging 0.98
R7358:Knl1 UTSW 2 119070559 missense possibly damaging 0.92
R7402:Knl1 UTSW 2 119095226 nonsense probably null
R7408:Knl1 UTSW 2 119070592 missense possibly damaging 0.54
R7475:Knl1 UTSW 2 119087546 missense probably damaging 1.00
R7516:Knl1 UTSW 2 119070698 missense probably damaging 0.99
R7524:Knl1 UTSW 2 119065979 missense probably damaging 1.00
R7559:Knl1 UTSW 2 119094006 missense possibly damaging 0.84
R7607:Knl1 UTSW 2 119095133 missense possibly damaging 0.93
R7745:Knl1 UTSW 2 119071556 missense probably benign 0.13
R7847:Knl1 UTSW 2 119070976 missense probably benign 0.02
R8423:Knl1 UTSW 2 119070032 missense probably damaging 1.00
R8725:Knl1 UTSW 2 119069043 missense probably benign 0.34
R8727:Knl1 UTSW 2 119069043 missense probably benign 0.34
Predicted Primers PCR Primer
(F):5'- AAGGCTCTTTCCCAAACCCTG -3'
(R):5'- ATAAGATTTCGGAGCACCATTTCC -3'

Sequencing Primer
(F):5'- CAGATTTCTAGTCAAAGTGCCAGC -3'
(R):5'- GCACCATTTCCTTTTCAAATATTGG -3'
Posted On2015-10-21