Mutagenetix > Incidental Mutation

Incidental Mutation 'R4713:Knl1'

353344

Institutional Source

Beutler Lab

Gene Symbol

Knl1

Ensembl Gene

ENSMUSG00000027326

Gene Name

kinetochore scaffold 1

Synonyms

2310043D08Rik, 5730505K17Rik

MMRRC Submission

041601-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R4713 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

119047119-119105501 bp(+) (GRCm38)

Type of Mutation

nonsense

DNA Base Change (assembly)

A to T at 119069137 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Lysine to Stop codon at position 440 (K440*)

Ref Sequence

ENSEMBL: ENSMUSP00000118646 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000028799] [ENSMUST00000028802] [ENSMUST00000099542] [ENSMUST00000152380] [ENSMUST00000153300]

AlphaFold

Q66JQ7

Predicted Effect

probably null
Transcript: ENSMUST00000028799
AA Change: K440*

SMART Domains

Protein: ENSMUSP00000028799
Gene: ENSMUSG00000027326
AA Change: K440*

Domain	Start	End	E-Value	Type
low complexity region	49	58	N/A	INTRINSIC
PDB:4A1G\|H	126	175	1e-13	PDB
low complexity region	426	433	N/A	INTRINSIC
low complexity region	883	894	N/A	INTRINSIC
low complexity region	1148	1159	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000028802
AA Change: K440*

SMART Domains

Protein: ENSMUSP00000028802
Gene: ENSMUSG00000027326
AA Change: K440*

Domain	Start	End	E-Value	Type
low complexity region	49	58	N/A	INTRINSIC
internal_repeat_1	98	304	1.57e-6	PROSPERO
low complexity region	426	433	N/A	INTRINSIC
internal_repeat_1	610	824	1.57e-6	PROSPERO
low complexity region	883	894	N/A	INTRINSIC
low complexity region	1148	1159	N/A	INTRINSIC
low complexity region	1621	1644	N/A	INTRINSIC
coiled coil region	1724	1755	N/A	INTRINSIC
low complexity region	1836	1850	N/A	INTRINSIC
low complexity region	1864	1878	N/A	INTRINSIC
PDB:4NF9\|B	1899	2119	1e-115	PDB

Predicted Effect

probably null
Transcript: ENSMUST00000099542
AA Change: K440*

SMART Domains

Protein: ENSMUSP00000097140
Gene: ENSMUSG00000027326
AA Change: K440*

Domain	Start	End	E-Value	Type
low complexity region	49	58	N/A	INTRINSIC
internal_repeat_1	98	304	1.57e-6	PROSPERO
low complexity region	426	433	N/A	INTRINSIC
internal_repeat_1	610	824	1.57e-6	PROSPERO
low complexity region	883	894	N/A	INTRINSIC
low complexity region	1148	1159	N/A	INTRINSIC
low complexity region	1621	1644	N/A	INTRINSIC
coiled coil region	1724	1755	N/A	INTRINSIC
low complexity region	1836	1850	N/A	INTRINSIC
low complexity region	1864	1878	N/A	INTRINSIC
PDB:4NF9\|B	1899	2119	1e-115	PDB

Predicted Effect

probably null
Transcript: ENSMUST00000152380
AA Change: K440*

SMART Domains

Protein: ENSMUSP00000118646
Gene: ENSMUSG00000027326
AA Change: K440*

Domain	Start	End	E-Value	Type
low complexity region	49	58	N/A	INTRINSIC
PDB:4A1G\|H	126	175	3e-14	PDB
low complexity region	426	433	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000153300

SMART Domains

Protein: ENSMUSP00000120905
Gene: ENSMUSG00000027326

Domain	Start	End	E-Value	Type
low complexity region	49	58	N/A	INTRINSIC

Coding Region Coverage

1x: 99.1%
3x: 98.5%
10x: 96.7%
20x: 94.0%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a component of the multiprotein assembly that is required for creation of kinetochore-microtubule attachments and chromosome segregation. The encoded protein functions as a scaffold for proteins that influence the spindle assembly checkpoint during the eukaryotic cell cycle and it interacts with at least five different kinetochore proteins and two checkpoint kinases. In adults, this gene is predominantly expressed in normal testes, various cancer cell lines and primary tumors from other tissues and is ubiquitously expressed in fetal tissues. This gene was originally identified as a fusion partner with the mixed-lineage leukemia (MLL) gene in t(11;15)(q23;q14). Mutations in this gene cause autosomal recessive primary microcephaly-4 (MCPH4). Alternative splicing results in multiple transcript variants encoding different isoforms. Additional splice variants have been described but their biological validity has not been confirmed. [provided by RefSeq, Jan 2013]
PHENOTYPE: Mice homozygous for a transgenic gene disruption exhibit embryonic lethality at E6. Mice homozygous for an ENU-induced allele exhibit possible embryonic lethality. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 60 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adgrb3	G	T	1: 25,547,532	T360K	probably damaging	Het
AW551984	T	C	9: 39,597,153	K356E	probably benign	Het
Bpifb2	T	A	2: 153,881,193	V123E	probably damaging	Het
Cacna1a	T	G	8: 84,549,514	F532V	probably damaging	Het
Cct8	C	A	16: 87,487,688	E204*	probably null	Het
Cd163	T	A	6: 124,317,618		probably null	Het
Cep152	C	A	2: 125,587,948	A685S	possibly damaging	Het
Chdh	A	G	14: 30,036,841	D581G	probably benign	Het
Cnpy3	A	C	17: 46,747,465	Y77*	probably null	Het
Col5a3	T	C	9: 20,793,574	E762G	unknown	Het
Creb3	A	G	4: 43,563,247	T115A	probably benign	Het
Dlat	G	T	9: 50,644,481	A412E	probably benign	Het
Dnah2	T	C	11: 69,476,688	N1789S	probably damaging	Het
Dzank1	C	T	2: 144,491,804	E370K	probably benign	Het
Eif3m	A	T	2: 105,006,839		probably null	Het
Gimap8	A	T	6: 48,658,986	M562L	probably benign	Het
Gm15448	G	T	7: 3,822,681	Y396*	probably null	Het
Gprc6a	T	A	10: 51,631,457		probably benign	Het
Gsr	T	G	8: 33,680,319		probably null	Het
Gstcd	A	G	3: 132,983,099	V630A	probably damaging	Het
Hip1r	T	C	5: 123,989,980	I116T	probably benign	Het
Hivep3	A	G	4: 120,131,803	E1817G	probably damaging	Het
Inpp5f	A	C	7: 128,663,725	T135P	probably damaging	Het
Ism2	A	G	12: 87,285,027		silent	Het
Itga11	A	G	9: 62,765,788	D784G	probably damaging	Het
Itpr2	A	G	6: 146,373,173	F837S	probably damaging	Het
Itpr2	T	C	6: 146,396,958	E10G	probably damaging	Het
Lonp2	T	C	8: 86,713,315	S648P	probably damaging	Het
Lrba	T	C	3: 86,359,868	S1622P	probably benign	Het
Lrp2	G	T	2: 69,487,966	A2047D	probably damaging	Het
Mcm3	G	A	1: 20,803,577	T773I	probably benign	Het
Mfsd7a	T	C	5: 108,442,079	T486A	probably damaging	Het
Mki67	A	G	7: 135,695,469	V2612A	probably benign	Het
Mnx1	C	A	5: 29,478,131	G49W	probably damaging	Het
Muc5b	T	A	7: 141,849,079	Y673*	probably null	Het
Myo15	A	G	11: 60,479,930	H1172R	probably benign	Het
Myo1g	T	C	11: 6,516,080	K363R	probably null	Het
Ncoa4	T	A	14: 32,176,641	C473S	probably benign	Het
Nefh	T	C	11: 4,939,656	T988A	unknown	Het
Nwd2	T	A	5: 63,804,460	D462E	probably benign	Het
Olfr332	T	C	11: 58,490,087	T223A	probably benign	Het
Plec	T	C	15: 76,181,067	E1466G	unknown	Het
Prl3d2	G	T	13: 27,122,396	M35I	probably benign	Het
Reln	T	A	5: 22,152,463	I202F	probably benign	Het
Rhot1	T	A	11: 80,225,602	D78E	probably benign	Het
Rsph3b	T	C	17: 6,905,129		probably null	Het
Scn10a	C	T	9: 119,609,651	M1717I	probably damaging	Het
Sema6a	T	A	18: 47,249,296	H728L	possibly damaging	Het
Slc26a3	G	T	12: 31,457,080	A345S	possibly damaging	Het
Slc35d2	A	G	13: 64,099,283	V261A	possibly damaging	Het
Ssmem1	A	G	6: 30,519,514	D66G	probably damaging	Het
Sult2a8	A	T	7: 14,425,477	N72K	probably benign	Het
Tbx10	T	C	19: 3,996,921	L108P	probably damaging	Het
Tex14	T	C	11: 87,536,865	S48P	probably damaging	Het
Tmie	A	G	9: 110,867,528	L95P	probably damaging	Het
Tom1l2	C	G	11: 60,270,433	R84P	probably damaging	Het
Trpm3	T	A	19: 22,889,435	D543E	possibly damaging	Het
Vipr2	A	C	12: 116,080,131	R49S	probably benign	Het
Vps8	A	T	16: 21,442,439	S110C	probably damaging	Het
Zfp791	T	A	8: 85,110,968	N89I	probably damaging	Het

Other mutations in Knl1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00272:Knl1	APN	2	119064083	missense	probably damaging	0.96
IGL00582:Knl1	APN	2	119102499	missense	probably benign	0.19
IGL00666:Knl1	APN	2	119070464	missense	probably damaging	0.96
IGL01062:Knl1	APN	2	119076980	missense	probably benign	0.33
IGL01395:Knl1	APN	2	119071566	missense	probably damaging	0.96
IGL01604:Knl1	APN	2	119070001	missense	probably damaging	1.00
IGL01996:Knl1	APN	2	119104061	missense	probably damaging	1.00
IGL02086:Knl1	APN	2	119100774	missense	probably benign	0.40
IGL02105:Knl1	APN	2	119071808	missense	probably benign
IGL02106:Knl1	APN	2	119072008	missense	possibly damaging	0.89
IGL02201:Knl1	APN	2	119069152	missense	probably benign	0.01
IGL02252:Knl1	APN	2	119072540	missense	probably damaging	1.00
IGL02414:Knl1	APN	2	119070323	missense	possibly damaging	0.83
IGL02655:Knl1	APN	2	119070992	missense	possibly damaging	0.62
IGL02682:Knl1	APN	2	119077969	missense	possibly damaging	0.86
IGL02710:Knl1	APN	2	119070930	missense	probably damaging	0.99
IGL02877:Knl1	APN	2	119088831	missense	probably benign	0.08
IGL03100:Knl1	APN	2	119100770	missense	probably damaging	0.99
IGL03210:Knl1	APN	2	119070617	missense	probably benign	0.02
IGL03138:Knl1	UTSW	2	119072359	missense	probably damaging	0.96
R0023:Knl1	UTSW	2	119102549	missense	possibly damaging	0.73
R0064:Knl1	UTSW	2	119076243	missense	probably benign	0.00
R0064:Knl1	UTSW	2	119076243	missense	probably benign	0.00
R0078:Knl1	UTSW	2	119069892	missense	probably benign	0.16
R0178:Knl1	UTSW	2	119058405	splice site	probably benign
R0295:Knl1	UTSW	2	119088839	missense	probably damaging	1.00
R0433:Knl1	UTSW	2	119104061	missense	probably damaging	0.96
R0453:Knl1	UTSW	2	119068388	missense	probably damaging	1.00
R0569:Knl1	UTSW	2	119097435	missense	possibly damaging	0.95
R0827:Knl1	UTSW	2	119088901	splice site	probably benign
R0920:Knl1	UTSW	2	119069828	missense	probably benign	0.00
R1120:Knl1	UTSW	2	119062375	missense	probably damaging	0.99
R1155:Knl1	UTSW	2	119071154	missense	possibly damaging	0.90
R1204:Knl1	UTSW	2	119071189	missense	probably benign	0.00
R1241:Knl1	UTSW	2	119072573	missense	probably benign	0.03
R1387:Knl1	UTSW	2	119070730	missense	possibly damaging	0.93
R1448:Knl1	UTSW	2	119068307	missense	probably damaging	1.00
R1469:Knl1	UTSW	2	119071346	missense	possibly damaging	0.73
R1469:Knl1	UTSW	2	119071346	missense	possibly damaging	0.73
R1719:Knl1	UTSW	2	119071738	missense	probably benign	0.01
R1721:Knl1	UTSW	2	119076334	missense	probably damaging	1.00
R2128:Knl1	UTSW	2	119071819	missense	possibly damaging	0.79
R2170:Knl1	UTSW	2	119087594	critical splice donor site	probably null
R2227:Knl1	UTSW	2	119072000	missense	probably damaging	0.97
R2246:Knl1	UTSW	2	119072227	missense	probably damaging	1.00
R2275:Knl1	UTSW	2	119072281	missense	probably damaging	0.99
R2508:Knl1	UTSW	2	119058368	nonsense	probably null
R3115:Knl1	UTSW	2	119070391	missense	possibly damaging	0.53
R3122:Knl1	UTSW	2	119068944	missense	probably benign	0.32
R3431:Knl1	UTSW	2	119062362	missense	probably damaging	1.00
R3755:Knl1	UTSW	2	119102579	missense	probably damaging	1.00
R4461:Knl1	UTSW	2	119059599	missense	probably benign	0.00
R4600:Knl1	UTSW	2	119070544	missense	possibly damaging	0.90
R4758:Knl1	UTSW	2	119071732	frame shift	probably null
R4762:Knl1	UTSW	2	119071936	missense	probably benign	0.01
R4869:Knl1	UTSW	2	119072351	missense	possibly damaging	0.73
R4870:Knl1	UTSW	2	119081513	missense	probably benign	0.22
R4935:Knl1	UTSW	2	119068957	missense	possibly damaging	0.50
R5167:Knl1	UTSW	2	119070031	missense	probably damaging	1.00
R5184:Knl1	UTSW	2	119069176	missense	probably damaging	1.00
R5293:Knl1	UTSW	2	119069695	missense	probably damaging	0.99
R5326:Knl1	UTSW	2	119068348	missense	possibly damaging	0.66
R5331:Knl1	UTSW	2	119070255	missense	possibly damaging	0.92
R5353:Knl1	UTSW	2	119070983	missense	probably benign	0.01
R5493:Knl1	UTSW	2	119068730	missense	probably damaging	0.98
R5542:Knl1	UTSW	2	119068348	missense	possibly damaging	0.66
R5632:Knl1	UTSW	2	119070352	missense	probably damaging	1.00
R5650:Knl1	UTSW	2	119081550	nonsense	probably null
R5854:Knl1	UTSW	2	119070403	missense	probably benign	0.02
R5979:Knl1	UTSW	2	119069360	missense	possibly damaging	0.83
R6086:Knl1	UTSW	2	119094068	missense	probably damaging	1.00
R6283:Knl1	UTSW	2	119070286	missense	probably damaging	1.00
R6285:Knl1	UTSW	2	119071941	missense	probably damaging	1.00
R6313:Knl1	UTSW	2	119069318	missense	probably damaging	1.00
R6419:Knl1	UTSW	2	119069003	missense	probably benign	0.02
R6608:Knl1	UTSW	2	119086612	missense	probably damaging	0.99
R6881:Knl1	UTSW	2	119095184	missense	possibly damaging	0.67
R7161:Knl1	UTSW	2	119070785	missense	possibly damaging	0.79
R7206:Knl1	UTSW	2	119069299	missense	probably benign	0.35
R7270:Knl1	UTSW	2	119102522	missense	possibly damaging	0.53
R7276:Knl1	UTSW	2	119071686	missense	probably damaging	0.98
R7358:Knl1	UTSW	2	119070559	missense	possibly damaging	0.92
R7402:Knl1	UTSW	2	119095226	nonsense	probably null
R7408:Knl1	UTSW	2	119070592	missense	possibly damaging	0.54
R7475:Knl1	UTSW	2	119087546	missense	probably damaging	1.00
R7516:Knl1	UTSW	2	119070698	missense	probably damaging	0.99
R7524:Knl1	UTSW	2	119065979	missense	probably damaging	1.00
R7559:Knl1	UTSW	2	119094006	missense	possibly damaging	0.84
R7607:Knl1	UTSW	2	119095133	missense	possibly damaging	0.93
R7745:Knl1	UTSW	2	119071556	missense	probably benign	0.13
R7847:Knl1	UTSW	2	119070976	missense	probably benign	0.02
R8423:Knl1	UTSW	2	119070032	missense	probably damaging	1.00
R8725:Knl1	UTSW	2	119069043	missense	probably benign	0.34
R8727:Knl1	UTSW	2	119069043	missense	probably benign	0.34
R8995:Knl1	UTSW	2	119072509	missense	probably benign	0.11
R9023:Knl1	UTSW	2	119070280	missense	probably benign	0.27
R9100:Knl1	UTSW	2	119068988	missense	probably benign	0.02
R9102:Knl1	UTSW	2	119087492	missense	probably benign	0.22
R9303:Knl1	UTSW	2	119068348	missense	possibly damaging	0.83
R9400:Knl1	UTSW	2	119100743	missense	probably damaging	0.98
R9426:Knl1	UTSW	2	119069498	missense	possibly damaging	0.81
R9583:Knl1	UTSW	2	119057301	missense	probably damaging	1.00
R9616:Knl1	UTSW	2	119069513	missense	probably benign	0.02
R9616:Knl1	UTSW	2	119076944	missense	probably damaging	1.00
R9671:Knl1	UTSW	2	119070608	missense	probably damaging	1.00
R9766:Knl1	UTSW	2	119069900	missense	probably damaging	1.00
R9782:Knl1	UTSW	2	119069429	missense	probably benign	0.02

Predicted Primers

PCR Primer
(F):5'- AAGGCTCTTTCCCAAACCCTG -3'
(R):5'- ATAAGATTTCGGAGCACCATTTCC -3'

Sequencing Primer
(F):5'- CAGATTTCTAGTCAAAGTGCCAGC -3'
(R):5'- GCACCATTTCCTTTTCAAATATTGG -3'

Posted On

2015-10-21