Incidental Mutation 'R4713:Nwd2'
ID353356
Institutional Source Beutler Lab
Gene Symbol Nwd2
Ensembl Gene ENSMUSG00000090061
Gene NameNACHT and WD repeat domain containing 2
Synonyms3110047P20Rik, B830017A01Rik
MMRRC Submission 041601-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.171) question?
Stock #R4713 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location63649102-63810546 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 63804460 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 462 (D462E)
Ref Sequence ENSEMBL: ENSMUSP00000124712 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000159584] [ENSMUST00000162166]
Predicted Effect probably benign
Transcript: ENSMUST00000159584
AA Change: D462E

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000124712
Gene: ENSMUSG00000090061
AA Change: D462E

DomainStartEndE-ValueType
Pfam:DUF4062 42 145 1.5e-8 PFAM
Blast:AAA 408 691 3e-29 BLAST
WD40 939 995 1.06e2 SMART
WD40 998 1037 8.96e-2 SMART
Blast:WD40 1091 1126 9e-19 BLAST
Blast:WD40 1129 1170 1e-17 BLAST
Blast:WD40 1220 1260 3e-16 BLAST
WD40 1263 1302 3.4e-2 SMART
WD40 1347 1385 2.65e1 SMART
WD40 1386 1425 1.58e2 SMART
Blast:WD40 1466 1507 3e-19 BLAST
Blast:WD40 1606 1644 4e-18 BLAST
Blast:KR 1686 1730 2e-16 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000162166
Predicted Effect probably benign
Transcript: ENSMUST00000162757
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.7%
  • 20x: 94.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrb3 G T 1: 25,547,532 T360K probably damaging Het
AW551984 T C 9: 39,597,153 K356E probably benign Het
Bpifb2 T A 2: 153,881,193 V123E probably damaging Het
Cacna1a T G 8: 84,549,514 F532V probably damaging Het
Cct8 C A 16: 87,487,688 E204* probably null Het
Cd163 T A 6: 124,317,618 probably null Het
Cep152 C A 2: 125,587,948 A685S possibly damaging Het
Chdh A G 14: 30,036,841 D581G probably benign Het
Cnpy3 A C 17: 46,747,465 Y77* probably null Het
Col5a3 T C 9: 20,793,574 E762G unknown Het
Creb3 A G 4: 43,563,247 T115A probably benign Het
Dlat G T 9: 50,644,481 A412E probably benign Het
Dnah2 T C 11: 69,476,688 N1789S probably damaging Het
Dzank1 C T 2: 144,491,804 E370K probably benign Het
Eif3m A T 2: 105,006,839 probably null Het
Gimap8 A T 6: 48,658,986 M562L probably benign Het
Gm15448 G T 7: 3,822,681 Y396* probably null Het
Gprc6a T A 10: 51,631,457 probably benign Het
Gsr T G 8: 33,680,319 probably null Het
Gstcd A G 3: 132,983,099 V630A probably damaging Het
Hip1r T C 5: 123,989,980 I116T probably benign Het
Hivep3 A G 4: 120,131,803 E1817G probably damaging Het
Inpp5f A C 7: 128,663,725 T135P probably damaging Het
Ism2 A G 12: 87,285,027 silent Het
Itga11 A G 9: 62,765,788 D784G probably damaging Het
Itpr2 A G 6: 146,373,173 F837S probably damaging Het
Itpr2 T C 6: 146,396,958 E10G probably damaging Het
Knl1 A T 2: 119,069,137 K440* probably null Het
Lonp2 T C 8: 86,713,315 S648P probably damaging Het
Lrba T C 3: 86,359,868 S1622P probably benign Het
Lrp2 G T 2: 69,487,966 A2047D probably damaging Het
Mcm3 G A 1: 20,803,577 T773I probably benign Het
Mfsd7a T C 5: 108,442,079 T486A probably damaging Het
Mki67 A G 7: 135,695,469 V2612A probably benign Het
Mnx1 C A 5: 29,478,131 G49W probably damaging Het
Muc5b T A 7: 141,849,079 Y673* probably null Het
Myo15 A G 11: 60,479,930 H1172R probably benign Het
Myo1g T C 11: 6,516,080 K363R probably null Het
Ncoa4 T A 14: 32,176,641 C473S probably benign Het
Nefh T C 11: 4,939,656 T988A unknown Het
Olfr332 T C 11: 58,490,087 T223A probably benign Het
Plec T C 15: 76,181,067 E1466G unknown Het
Prl3d2 G T 13: 27,122,396 M35I probably benign Het
Reln T A 5: 22,152,463 I202F probably benign Het
Rhot1 T A 11: 80,225,602 D78E probably benign Het
Rsph3b T C 17: 6,905,129 probably null Het
Scn10a C T 9: 119,609,651 M1717I probably damaging Het
Sema6a T A 18: 47,249,296 H728L possibly damaging Het
Slc26a3 G T 12: 31,457,080 A345S possibly damaging Het
Slc35d2 A G 13: 64,099,283 V261A possibly damaging Het
Ssmem1 A G 6: 30,519,514 D66G probably damaging Het
Sult2a8 A T 7: 14,425,477 N72K probably benign Het
Tbx10 T C 19: 3,996,921 L108P probably damaging Het
Tex14 T C 11: 87,536,865 S48P probably damaging Het
Tmie A G 9: 110,867,528 L95P probably damaging Het
Tom1l2 C G 11: 60,270,433 R84P probably damaging Het
Trpm3 T A 19: 22,889,435 D543E possibly damaging Het
Vipr2 A C 12: 116,080,131 R49S probably benign Het
Vps8 A T 16: 21,442,439 S110C probably damaging Het
Zfp791 T A 8: 85,110,968 N89I probably damaging Het
Other mutations in Nwd2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00325:Nwd2 APN 5 63805475 missense probably benign
IGL01111:Nwd2 APN 5 63807300 missense probably damaging 1.00
IGL01152:Nwd2 APN 5 63806529 missense possibly damaging 0.74
IGL01307:Nwd2 APN 5 63808283 missense possibly damaging 0.95
IGL01449:Nwd2 APN 5 63805594 missense probably damaging 1.00
IGL01624:Nwd2 APN 5 63806810 missense probably damaging 1.00
IGL01997:Nwd2 APN 5 63804595 missense probably damaging 0.99
IGL02007:Nwd2 APN 5 63804699 missense possibly damaging 0.87
IGL02143:Nwd2 APN 5 63791653 splice site probably null
IGL02184:Nwd2 APN 5 63805677 missense probably damaging 1.00
IGL02379:Nwd2 APN 5 63805301 missense probably damaging 1.00
IGL02489:Nwd2 APN 5 63805227 missense probably damaging 1.00
IGL02580:Nwd2 APN 5 63808169 missense probably damaging 0.99
IGL02682:Nwd2 APN 5 63804677 missense probably benign 0.03
IGL02682:Nwd2 APN 5 63804678 missense probably damaging 1.00
IGL02891:Nwd2 APN 5 63725227 missense possibly damaging 0.91
IGL03135:Nwd2 APN 5 63805995 missense probably damaging 1.00
IGL03149:Nwd2 APN 5 63805995 missense probably damaging 1.00
R0113:Nwd2 UTSW 5 63807898 missense probably damaging 1.00
R0172:Nwd2 UTSW 5 63806369 missense probably benign 0.44
R0196:Nwd2 UTSW 5 63806351 missense probably benign 0.37
R0239:Nwd2 UTSW 5 63800124 missense probably benign 0.01
R0239:Nwd2 UTSW 5 63800124 missense probably benign 0.01
R0309:Nwd2 UTSW 5 63807218 missense probably damaging 1.00
R0311:Nwd2 UTSW 5 63804998 missense probably damaging 0.99
R0335:Nwd2 UTSW 5 63804773 missense probably benign 0.00
R0384:Nwd2 UTSW 5 63805682 missense probably benign 0.11
R0496:Nwd2 UTSW 5 63806343 missense probably damaging 0.99
R0497:Nwd2 UTSW 5 63806343 missense probably damaging 0.99
R0498:Nwd2 UTSW 5 63806343 missense probably damaging 0.99
R0505:Nwd2 UTSW 5 63805111 missense probably damaging 1.00
R0655:Nwd2 UTSW 5 63791585 missense possibly damaging 0.73
R0762:Nwd2 UTSW 5 63800414 missense probably benign 0.33
R0835:Nwd2 UTSW 5 63800130 missense probably damaging 0.99
R0926:Nwd2 UTSW 5 63807891 missense probably damaging 0.99
R0948:Nwd2 UTSW 5 63807312 missense probably damaging 1.00
R1015:Nwd2 UTSW 5 63806811 missense probably damaging 1.00
R1086:Nwd2 UTSW 5 63806574 missense probably damaging 1.00
R1186:Nwd2 UTSW 5 63650024 utr 5 prime probably benign
R1305:Nwd2 UTSW 5 63745197 missense probably damaging 0.97
R1542:Nwd2 UTSW 5 63806975 missense probably damaging 1.00
R1548:Nwd2 UTSW 5 63800182 missense probably benign 0.00
R1553:Nwd2 UTSW 5 63800505 missense probably benign 0.00
R1636:Nwd2 UTSW 5 63807557 missense probably damaging 1.00
R1658:Nwd2 UTSW 5 63807246 missense probably damaging 1.00
R1763:Nwd2 UTSW 5 63808271 missense probably benign
R1800:Nwd2 UTSW 5 63805574 missense probably benign 0.15
R1813:Nwd2 UTSW 5 63805410 missense probably benign 0.00
R1861:Nwd2 UTSW 5 63804854 missense probably damaging 0.96
R1889:Nwd2 UTSW 5 63807666 missense possibly damaging 0.49
R1896:Nwd2 UTSW 5 63805410 missense probably benign 0.00
R1919:Nwd2 UTSW 5 63806180 missense probably damaging 1.00
R1922:Nwd2 UTSW 5 63794242 missense probably benign
R2258:Nwd2 UTSW 5 63805156 missense probably benign 0.00
R2292:Nwd2 UTSW 5 63805574 missense probably benign 0.15
R2504:Nwd2 UTSW 5 63804374 missense probably benign 0.02
R2869:Nwd2 UTSW 5 63800328 missense probably benign 0.00
R2869:Nwd2 UTSW 5 63800328 missense probably benign 0.00
R2958:Nwd2 UTSW 5 63805982 missense probably benign 0.01
R3034:Nwd2 UTSW 5 63800103 missense probably damaging 1.00
R3422:Nwd2 UTSW 5 63725193 missense possibly damaging 0.46
R3423:Nwd2 UTSW 5 63800161 missense probably damaging 1.00
R3439:Nwd2 UTSW 5 63804552 missense probably benign 0.00
R4193:Nwd2 UTSW 5 63807465 missense probably damaging 1.00
R4254:Nwd2 UTSW 5 63806546 missense possibly damaging 0.74
R4384:Nwd2 UTSW 5 63806571 missense probably damaging 1.00
R4707:Nwd2 UTSW 5 63794322 missense probably damaging 1.00
R4735:Nwd2 UTSW 5 63808251 missense probably benign 0.34
R4744:Nwd2 UTSW 5 63806967 missense probably damaging 1.00
R4795:Nwd2 UTSW 5 63805433 missense probably benign 0.21
R4835:Nwd2 UTSW 5 63807846 missense probably benign 0.00
R4839:Nwd2 UTSW 5 63805550 missense possibly damaging 0.92
R4896:Nwd2 UTSW 5 63804808 missense probably damaging 1.00
R5017:Nwd2 UTSW 5 63650141 utr 5 prime probably benign
R5170:Nwd2 UTSW 5 63806037 missense probably damaging 0.99
R5312:Nwd2 UTSW 5 63806072 nonsense probably null
R5330:Nwd2 UTSW 5 63806516 missense probably benign 0.02
R5331:Nwd2 UTSW 5 63806516 missense probably benign 0.02
R5419:Nwd2 UTSW 5 63807708 missense probably benign 0.11
R5434:Nwd2 UTSW 5 63807648 missense probably benign 0.00
R5445:Nwd2 UTSW 5 63805338 missense probably damaging 1.00
R5761:Nwd2 UTSW 5 63725230 missense probably damaging 1.00
R5788:Nwd2 UTSW 5 63807771 missense probably benign 0.00
R5907:Nwd2 UTSW 5 63805983 missense probably damaging 0.99
R5959:Nwd2 UTSW 5 63808070 missense probably benign 0.32
R6002:Nwd2 UTSW 5 63804800 missense probably benign
R6027:Nwd2 UTSW 5 63808220 missense possibly damaging 0.65
R6082:Nwd2 UTSW 5 63805031 missense possibly damaging 0.96
R6163:Nwd2 UTSW 5 63805788 missense probably benign 0.00
R6172:Nwd2 UTSW 5 63806906 missense probably damaging 0.98
R6334:Nwd2 UTSW 5 63800253 missense possibly damaging 0.95
R6447:Nwd2 UTSW 5 63807555 missense probably benign 0.41
R6649:Nwd2 UTSW 5 63725184 missense possibly damaging 0.89
R6855:Nwd2 UTSW 5 63804451 missense probably benign 0.00
R7034:Nwd2 UTSW 5 63804915 missense probably damaging 1.00
R7168:Nwd2 UTSW 5 63807494 missense probably benign 0.04
R7326:Nwd2 UTSW 5 63800409 missense probably damaging 1.00
R7561:Nwd2 UTSW 5 63807091 nonsense probably null
R7576:Nwd2 UTSW 5 63807393 missense probably benign 0.00
R7580:Nwd2 UTSW 5 63808281 missense probably benign 0.05
R7723:Nwd2 UTSW 5 63808004 missense possibly damaging 0.69
R7769:Nwd2 UTSW 5 63804504 missense probably damaging 0.99
RF020:Nwd2 UTSW 5 63805723 nonsense probably null
X0023:Nwd2 UTSW 5 63806963 missense probably damaging 0.99
Z1176:Nwd2 UTSW 5 63725197 missense probably damaging 1.00
Z1176:Nwd2 UTSW 5 63806157 missense probably damaging 1.00
Z1177:Nwd2 UTSW 5 63804984 missense possibly damaging 0.60
Z1177:Nwd2 UTSW 5 63807326 nonsense probably null
Predicted Primers PCR Primer
(F):5'- CACTTTGGCCTTCCCAGATG -3'
(R):5'- CTGCTCTAGGGCATCCAATATG -3'

Sequencing Primer
(F):5'- CAAGGATAGTGTTAGTCTGAGCTCC -3'
(R):5'- GCTCTAGGGCATCCAATATGATTACC -3'
Posted On2015-10-21