Incidental Mutation 'R4713:Hip1r'
ID353358
Institutional Source Beutler Lab
Gene Symbol Hip1r
Ensembl Gene ENSMUSG00000000915
Gene Namehuntingtin interacting protein 1 related
Synonyms
MMRRC Submission 041601-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4713 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location123973628-124005558 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 123989980 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 116 (I116T)
Ref Sequence ENSEMBL: ENSMUSP00000127361 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000000939] [ENSMUST00000167879]
Predicted Effect probably benign
Transcript: ENSMUST00000000939
AA Change: I115T

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000000939
Gene: ENSMUSG00000000915
AA Change: I115T

DomainStartEndE-ValueType
ENTH 29 151 5.27e-40 SMART
low complexity region 301 321 N/A INTRINSIC
PDB:3I00|B 340 458 1e-21 PDB
Pfam:HIP1_clath_bdg 461 559 1.1e-34 PFAM
low complexity region 627 633 N/A INTRINSIC
ILWEQ 814 1012 9.19e-121 SMART
low complexity region 1016 1035 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000166258
SMART Domains Protein: ENSMUSP00000130766
Gene: ENSMUSG00000000915

DomainStartEndE-ValueType
Pfam:ANTH 1 79 3.5e-19 PFAM
low complexity region 80 100 N/A INTRINSIC
low complexity region 103 114 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000167879
AA Change: I116T

PolyPhen 2 Score 0.021 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000127361
Gene: ENSMUSG00000000915
AA Change: I116T

DomainStartEndE-ValueType
Pfam:ANTH 29 117 1.3e-29 PFAM
Pfam:ENTH 30 117 6.1e-10 PFAM
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.7%
  • 20x: 94.0%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for disruptions in this gene display no abnormal phenotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrb3 G T 1: 25,547,532 T360K probably damaging Het
AW551984 T C 9: 39,597,153 K356E probably benign Het
Bpifb2 T A 2: 153,881,193 V123E probably damaging Het
Cacna1a T G 8: 84,549,514 F532V probably damaging Het
Cct8 C A 16: 87,487,688 E204* probably null Het
Cd163 T A 6: 124,317,618 probably null Het
Cep152 C A 2: 125,587,948 A685S possibly damaging Het
Chdh A G 14: 30,036,841 D581G probably benign Het
Cnpy3 A C 17: 46,747,465 Y77* probably null Het
Col5a3 T C 9: 20,793,574 E762G unknown Het
Creb3 A G 4: 43,563,247 T115A probably benign Het
Dlat G T 9: 50,644,481 A412E probably benign Het
Dnah2 T C 11: 69,476,688 N1789S probably damaging Het
Dzank1 C T 2: 144,491,804 E370K probably benign Het
Eif3m A T 2: 105,006,839 probably null Het
Gimap8 A T 6: 48,658,986 M562L probably benign Het
Gm15448 G T 7: 3,822,681 Y396* probably null Het
Gprc6a T A 10: 51,631,457 probably benign Het
Gsr T G 8: 33,680,319 probably null Het
Gstcd A G 3: 132,983,099 V630A probably damaging Het
Hivep3 A G 4: 120,131,803 E1817G probably damaging Het
Inpp5f A C 7: 128,663,725 T135P probably damaging Het
Ism2 A G 12: 87,285,027 silent Het
Itga11 A G 9: 62,765,788 D784G probably damaging Het
Itpr2 A G 6: 146,373,173 F837S probably damaging Het
Itpr2 T C 6: 146,396,958 E10G probably damaging Het
Knl1 A T 2: 119,069,137 K440* probably null Het
Lonp2 T C 8: 86,713,315 S648P probably damaging Het
Lrba T C 3: 86,359,868 S1622P probably benign Het
Lrp2 G T 2: 69,487,966 A2047D probably damaging Het
Mcm3 G A 1: 20,803,577 T773I probably benign Het
Mfsd7a T C 5: 108,442,079 T486A probably damaging Het
Mki67 A G 7: 135,695,469 V2612A probably benign Het
Mnx1 C A 5: 29,478,131 G49W probably damaging Het
Muc5b T A 7: 141,849,079 Y673* probably null Het
Myo15 A G 11: 60,479,930 H1172R probably benign Het
Myo1g T C 11: 6,516,080 K363R probably null Het
Ncoa4 T A 14: 32,176,641 C473S probably benign Het
Nefh T C 11: 4,939,656 T988A unknown Het
Nwd2 T A 5: 63,804,460 D462E probably benign Het
Olfr332 T C 11: 58,490,087 T223A probably benign Het
Plec T C 15: 76,181,067 E1466G unknown Het
Prl3d2 G T 13: 27,122,396 M35I probably benign Het
Reln T A 5: 22,152,463 I202F probably benign Het
Rhot1 T A 11: 80,225,602 D78E probably benign Het
Rsph3b T C 17: 6,905,129 probably null Het
Scn10a C T 9: 119,609,651 M1717I probably damaging Het
Sema6a T A 18: 47,249,296 H728L possibly damaging Het
Slc26a3 G T 12: 31,457,080 A345S possibly damaging Het
Slc35d2 A G 13: 64,099,283 V261A possibly damaging Het
Ssmem1 A G 6: 30,519,514 D66G probably damaging Het
Sult2a8 A T 7: 14,425,477 N72K probably benign Het
Tbx10 T C 19: 3,996,921 L108P probably damaging Het
Tex14 T C 11: 87,536,865 S48P probably damaging Het
Tmie A G 9: 110,867,528 L95P probably damaging Het
Tom1l2 C G 11: 60,270,433 R84P probably damaging Het
Trpm3 T A 19: 22,889,435 D543E possibly damaging Het
Vipr2 A C 12: 116,080,131 R49S probably benign Het
Vps8 A T 16: 21,442,439 S110C probably damaging Het
Zfp791 T A 8: 85,110,968 N89I probably damaging Het
Other mutations in Hip1r
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00089:Hip1r APN 5 123989735 critical splice donor site probably null
IGL01771:Hip1r APN 5 123999543 missense possibly damaging 0.95
IGL01804:Hip1r APN 5 124001550 critical splice donor site probably null
IGL02100:Hip1r APN 5 123998943 unclassified probably benign
IGL02139:Hip1r APN 5 123996244 missense probably damaging 1.00
IGL02321:Hip1r APN 5 123999890 missense probably damaging 0.99
IGL02562:Hip1r APN 5 123991523 unclassified probably benign
IGL02745:Hip1r APN 5 123990939 splice site probably null
IGL02798:Hip1r APN 5 123994712 unclassified probably benign
IGL03365:Hip1r APN 5 124000167 missense probably damaging 1.00
R0172:Hip1r UTSW 5 123996940 missense possibly damaging 0.47
R0546:Hip1r UTSW 5 123999051 missense possibly damaging 0.89
R0799:Hip1r UTSW 5 123996941 missense probably benign 0.00
R1588:Hip1r UTSW 5 123996575 missense probably damaging 0.98
R1590:Hip1r UTSW 5 124002140 missense probably benign 0.00
R1675:Hip1r UTSW 5 123994820 missense probably damaging 1.00
R1801:Hip1r UTSW 5 123998808 missense probably benign
R1818:Hip1r UTSW 5 123995955 critical splice donor site probably null
R1852:Hip1r UTSW 5 123991505 missense probably benign 0.10
R1936:Hip1r UTSW 5 123996071 missense probably damaging 1.00
R1954:Hip1r UTSW 5 124001844 missense probably damaging 0.96
R1989:Hip1r UTSW 5 123989698 missense probably damaging 1.00
R2045:Hip1r UTSW 5 124000731 missense probably benign
R2105:Hip1r UTSW 5 124000204 missense probably damaging 0.96
R2414:Hip1r UTSW 5 124001243 missense probably damaging 1.00
R2909:Hip1r UTSW 5 124000593 splice site probably null
R3125:Hip1r UTSW 5 124000141 missense probably benign 0.20
R3401:Hip1r UTSW 5 123996983 missense probably damaging 1.00
R3402:Hip1r UTSW 5 123996983 missense probably damaging 1.00
R3889:Hip1r UTSW 5 124001791 nonsense probably null
R4212:Hip1r UTSW 5 123999890 missense probably benign 0.06
R4421:Hip1r UTSW 5 123997862 missense possibly damaging 0.66
R4422:Hip1r UTSW 5 123997006 missense possibly damaging 0.93
R6837:Hip1r UTSW 5 123998865 missense possibly damaging 0.63
R7171:Hip1r UTSW 5 123995944 missense probably benign 0.02
R7212:Hip1r UTSW 5 123973782 missense possibly damaging 0.91
R7251:Hip1r UTSW 5 123994750 missense probably damaging 1.00
R7319:Hip1r UTSW 5 123999111 missense probably damaging 1.00
R7432:Hip1r UTSW 5 123991766 missense probably benign 0.05
Z1088:Hip1r UTSW 5 123999132 splice site probably null
Predicted Primers PCR Primer
(F):5'- GTATCCCATGGAAGTGTGCTGC -3'
(R):5'- GATCTTCACAGAGGCATGGG -3'

Sequencing Primer
(F):5'- CATGGAAGTGTGCTGCTCTGAC -3'
(R):5'- GTTGCCACCTGTTCCAAGTCAAG -3'
Posted On2015-10-21