Mutagenetix > Incidental Mutation

Incidental Mutation 'R4713:Gm15448'

353365

Institutional Source

Beutler Lab

Gene Symbol

Gm15448

Ensembl Gene

ENSMUSG00000074419

Gene Name

predicted gene 15448

Synonyms

ENSMUSG00000074419

MMRRC Submission

041601-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.048) question?

Stock #

R4713 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

3816781-3825687 bp(-) (GRCm38)

Type of Mutation

nonsense

DNA Base Change (assembly)

G to T at 3822681 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Stop codon at position 396 (Y396*)

Ref Sequence

ENSEMBL: ENSMUSP00000140974 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000094911] [ENSMUST00000108619] [ENSMUST00000108620] [ENSMUST00000153846] [ENSMUST00000189095]

AlphaFold

F6PZL4

Predicted Effect

probably null
Transcript: ENSMUST00000094911
AA Change: Y396*

SMART Domains

Protein: ENSMUSP00000092515
Gene: ENSMUSG00000074419
AA Change: Y396*

Domain	Start	End	E-Value	Type
IG_like	40	105	3.26e0	SMART
IG	129	315	1.37e-1	SMART
IG_like	237	302	2.2e-1	SMART
IG	328	415	6.31e-1	SMART
IG	430	519	8.01e-3	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000108619
AA Change: Y396*

SMART Domains

Protein: ENSMUSP00000104259
Gene: ENSMUSG00000074419
AA Change: Y396*

Domain	Start	End	E-Value	Type
IG_like	40	105	3.26e0	SMART
IG	129	315	1.37e-1	SMART
IG_like	237	302	2.2e-1	SMART
IG	328	415	6.31e-1	SMART
IG_like	429	517	6.02e0	SMART
IG	529	618	8.01e-3	SMART
low complexity region	637	646	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000108620
AA Change: Y396*

SMART Domains

Protein: ENSMUSP00000104260
Gene: ENSMUSG00000074419
AA Change: Y396*

Domain	Start	End	E-Value	Type
IG_like	40	105	3.26e0	SMART
IG	129	315	1.37e-1	SMART
IG_like	237	302	2.2e-1	SMART
IG	328	415	6.31e-1	SMART
IG	430	519	8.01e-3	SMART
low complexity region	538	547	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000153846
AA Change: Y396*

SMART Domains

Protein: ENSMUSP00000121707
Gene: ENSMUSG00000074419
AA Change: Y396*

Domain	Start	End	E-Value	Type
IG	7	96	8.01e-3	SMART
low complexity region	132	141	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000189095
AA Change: Y396*

SMART Domains

Protein: ENSMUSP00000140974
Gene: ENSMUSG00000074419
AA Change: Y396*

Domain	Start	End	E-Value	Type
signal peptide	1	24	N/A	INTRINSIC
IG_like	40	105	1.3e-2	SMART
IG	129	315	5.7e-4	SMART
IG_like	237	302	9e-4	SMART
IG	328	415	2.6e-3	SMART
IG_like	429	517	2.4e-2	SMART
IG	529	618	3.3e-5	SMART

Coding Region Coverage

1x: 99.1%
3x: 98.5%
10x: 96.7%
20x: 94.0%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 60 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adgrb3	G	T	1: 25,547,532	T360K	probably damaging	Het
AW551984	T	C	9: 39,597,153	K356E	probably benign	Het
Bpifb2	T	A	2: 153,881,193	V123E	probably damaging	Het
Cacna1a	T	G	8: 84,549,514	F532V	probably damaging	Het
Cct8	C	A	16: 87,487,688	E204*	probably null	Het
Cd163	T	A	6: 124,317,618		probably null	Het
Cep152	C	A	2: 125,587,948	A685S	possibly damaging	Het
Chdh	A	G	14: 30,036,841	D581G	probably benign	Het
Cnpy3	A	C	17: 46,747,465	Y77*	probably null	Het
Col5a3	T	C	9: 20,793,574	E762G	unknown	Het
Creb3	A	G	4: 43,563,247	T115A	probably benign	Het
Dlat	G	T	9: 50,644,481	A412E	probably benign	Het
Dnah2	T	C	11: 69,476,688	N1789S	probably damaging	Het
Dzank1	C	T	2: 144,491,804	E370K	probably benign	Het
Eif3m	A	T	2: 105,006,839		probably null	Het
Gimap8	A	T	6: 48,658,986	M562L	probably benign	Het
Gprc6a	T	A	10: 51,631,457		probably benign	Het
Gsr	T	G	8: 33,680,319		probably null	Het
Gstcd	A	G	3: 132,983,099	V630A	probably damaging	Het
Hip1r	T	C	5: 123,989,980	I116T	probably benign	Het
Hivep3	A	G	4: 120,131,803	E1817G	probably damaging	Het
Inpp5f	A	C	7: 128,663,725	T135P	probably damaging	Het
Ism2	A	G	12: 87,285,027		silent	Het
Itga11	A	G	9: 62,765,788	D784G	probably damaging	Het
Itpr2	A	G	6: 146,373,173	F837S	probably damaging	Het
Itpr2	T	C	6: 146,396,958	E10G	probably damaging	Het
Knl1	A	T	2: 119,069,137	K440*	probably null	Het
Lonp2	T	C	8: 86,713,315	S648P	probably damaging	Het
Lrba	T	C	3: 86,359,868	S1622P	probably benign	Het
Lrp2	G	T	2: 69,487,966	A2047D	probably damaging	Het
Mcm3	G	A	1: 20,803,577	T773I	probably benign	Het
Mfsd7a	T	C	5: 108,442,079	T486A	probably damaging	Het
Mki67	A	G	7: 135,695,469	V2612A	probably benign	Het
Mnx1	C	A	5: 29,478,131	G49W	probably damaging	Het
Muc5b	T	A	7: 141,849,079	Y673*	probably null	Het
Myo15	A	G	11: 60,479,930	H1172R	probably benign	Het
Myo1g	T	C	11: 6,516,080	K363R	probably null	Het
Ncoa4	T	A	14: 32,176,641	C473S	probably benign	Het
Nefh	T	C	11: 4,939,656	T988A	unknown	Het
Nwd2	T	A	5: 63,804,460	D462E	probably benign	Het
Olfr332	T	C	11: 58,490,087	T223A	probably benign	Het
Plec	T	C	15: 76,181,067	E1466G	unknown	Het
Prl3d2	G	T	13: 27,122,396	M35I	probably benign	Het
Reln	T	A	5: 22,152,463	I202F	probably benign	Het
Rhot1	T	A	11: 80,225,602	D78E	probably benign	Het
Rsph3b	T	C	17: 6,905,129		probably null	Het
Scn10a	C	T	9: 119,609,651	M1717I	probably damaging	Het
Sema6a	T	A	18: 47,249,296	H728L	possibly damaging	Het
Slc26a3	G	T	12: 31,457,080	A345S	possibly damaging	Het
Slc35d2	A	G	13: 64,099,283	V261A	possibly damaging	Het
Ssmem1	A	G	6: 30,519,514	D66G	probably damaging	Het
Sult2a8	A	T	7: 14,425,477	N72K	probably benign	Het
Tbx10	T	C	19: 3,996,921	L108P	probably damaging	Het
Tex14	T	C	11: 87,536,865	S48P	probably damaging	Het
Tmie	A	G	9: 110,867,528	L95P	probably damaging	Het
Tom1l2	C	G	11: 60,270,433	R84P	probably damaging	Het
Trpm3	T	A	19: 22,889,435	D543E	possibly damaging	Het
Vipr2	A	C	12: 116,080,131	R49S	probably benign	Het
Vps8	A	T	16: 21,442,439	S110C	probably damaging	Het
Zfp791	T	A	8: 85,110,968	N89I	probably damaging	Het

Other mutations in Gm15448

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00434:Gm15448	APN	7	3823089	missense	probably damaging	1.00
IGL01675:Gm15448	APN	7	3822608	splice site	probably benign
IGL02040:Gm15448	APN	7	3821517	splice site	probably benign
IGL02547:Gm15448	APN	7	3821661	missense	probably damaging	0.98
IGL02749:Gm15448	APN	7	3822625	missense	probably damaging	1.00
IGL02822:Gm15448	APN	7	3816918	missense	possibly damaging	0.50
IGL02883:Gm15448	APN	7	3822180	missense	possibly damaging	0.95
IGL03140:Gm15448	APN	7	3823248	missense	probably benign	0.00
IGL03185:Gm15448	APN	7	3823230	missense	probably damaging	1.00
IGL03212:Gm15448	APN	7	3823133	missense	probably benign	0.00
R0347:Gm15448	UTSW	7	3822874	missense	probably damaging	1.00
R0652:Gm15448	UTSW	7	3822763	missense	probably benign	0.02
R0668:Gm15448	UTSW	7	3822700	missense	probably damaging	0.99
R0724:Gm15448	UTSW	7	3816872	missense	possibly damaging	0.83
R0735:Gm15448	UTSW	7	3821782	missense	possibly damaging	0.79
R1074:Gm15448	UTSW	7	3823070	missense	probably damaging	1.00
R1339:Gm15448	UTSW	7	3822156	missense	probably damaging	1.00
R1541:Gm15448	UTSW	7	3816989	missense	probably damaging	1.00
R1570:Gm15448	UTSW	7	3823061	missense	probably benign	0.45
R1880:Gm15448	UTSW	7	3824951	critical splice donor site	probably null
R1892:Gm15448	UTSW	7	3824574	missense	probably benign	0.15
R1909:Gm15448	UTSW	7	3822919	missense	probably benign	0.31
R2881:Gm15448	UTSW	7	3825641	start codon destroyed	probably null	0.98
R2967:Gm15448	UTSW	7	3822687	missense	probably damaging	1.00
R2983:Gm15448	UTSW	7	3821575	missense	probably damaging	1.00
R4213:Gm15448	UTSW	7	3821554	missense	probably damaging	1.00
R4319:Gm15448	UTSW	7	3822755	missense	possibly damaging	0.46
R4320:Gm15448	UTSW	7	3822755	missense	possibly damaging	0.46
R4321:Gm15448	UTSW	7	3822755	missense	possibly damaging	0.46
R4322:Gm15448	UTSW	7	3822755	missense	possibly damaging	0.46
R4323:Gm15448	UTSW	7	3822755	missense	possibly damaging	0.46
R4536:Gm15448	UTSW	7	3822252	missense	probably benign	0.00
R4597:Gm15448	UTSW	7	3822155	missense	possibly damaging	0.81
R4725:Gm15448	UTSW	7	3821548	missense	probably benign
R4934:Gm15448	UTSW	7	3822677	missense	probably damaging	1.00
R4971:Gm15448	UTSW	7	3822806	missense	probably benign	0.00
R5138:Gm15448	UTSW	7	3824557	nonsense	probably null
R5805:Gm15448	UTSW	7	3822623	missense	probably benign	0.15
R5824:Gm15448	UTSW	7	3824754	missense	probably damaging	1.00
R5841:Gm15448	UTSW	7	3822899	nonsense	probably null
R6027:Gm15448	UTSW	7	3824639	missense	possibly damaging	0.94
R6214:Gm15448	UTSW	7	3821718	missense	probably damaging	0.99
R6329:Gm15448	UTSW	7	3822851	missense	probably damaging	1.00
R6429:Gm15448	UTSW	7	3822346	missense	possibly damaging	0.63
R6650:Gm15448	UTSW	7	3816899	missense	possibly damaging	0.83
R6681:Gm15448	UTSW	7	3822252	missense	probably benign	0.00
R6961:Gm15448	UTSW	7	3825125	missense	probably damaging	1.00
R6989:Gm15448	UTSW	7	3822164	missense	possibly damaging	0.95
R7025:Gm15448	UTSW	7	3821262	nonsense	probably null
R7071:Gm15448	UTSW	7	3821668	missense	unknown
R7194:Gm15448	UTSW	7	3824793	missense
R7215:Gm15448	UTSW	7	3822311	missense	unknown
R7580:Gm15448	UTSW	7	3824612	missense	unknown
R7776:Gm15448	UTSW	7	3823247	missense	unknown
R7863:Gm15448	UTSW	7	3824802	critical splice acceptor site	probably null
R7909:Gm15448	UTSW	7	3821709	missense	unknown
R8131:Gm15448	UTSW	7	3822162	nonsense	probably null
R8178:Gm15448	UTSW	7	3821261	missense	unknown
R8188:Gm15448	UTSW	7	3823127	missense	unknown
R8220:Gm15448	UTSW	7	3822904	missense	unknown
R8226:Gm15448	UTSW	7	3825110	missense
R8441:Gm15448	UTSW	7	3823302	nonsense	probably null
R8739:Gm15448	UTSW	7	3825189	missense
R8785:Gm15448	UTSW	7	3816929	missense	unknown
R8912:Gm15448	UTSW	7	3822819	missense	unknown
R8941:Gm15448	UTSW	7	3822381	missense	probably damaging	1.00
R8990:Gm15448	UTSW	7	3821274	missense	unknown
R9049:Gm15448	UTSW	7	3816891	missense	unknown
R9090:Gm15448	UTSW	7	3816998	missense	unknown
R9134:Gm15448	UTSW	7	3822183	missense
R9136:Gm15448	UTSW	7	3823286	missense
R9244:Gm15448	UTSW	7	3822227	missense	unknown
R9271:Gm15448	UTSW	7	3816998	missense	unknown
R9328:Gm15448	UTSW	7	3824581	missense	unknown

Predicted Primers

PCR Primer
(F):5'- AACACAGGCTCTCCATTTTGTC -3'
(R):5'- AACTCAGACTGTCAGCACTG -3'

Sequencing Primer
(F):5'- GTCCTTCTCTACCTGCAACTCAG -3'
(R):5'- GAGGAAACATGACACTCCACTGTG -3'

Posted On

2015-10-21