Incidental Mutation 'R4713:Gm15448'
ID353365
Institutional Source Beutler Lab
Gene Symbol Gm15448
Ensembl Gene ENSMUSG00000074419
Gene Namepredicted gene 15448
SynonymsENSMUSG00000074419
MMRRC Submission 041601-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.052) question?
Stock #R4713 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location3816781-3825687 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to T at 3822681 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Stop codon at position 396 (Y396*)
Ref Sequence ENSEMBL: ENSMUSP00000140974 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094911] [ENSMUST00000108619] [ENSMUST00000108620] [ENSMUST00000153846] [ENSMUST00000189095]
Predicted Effect probably null
Transcript: ENSMUST00000094911
AA Change: Y396*
SMART Domains Protein: ENSMUSP00000092515
Gene: ENSMUSG00000074419
AA Change: Y396*

DomainStartEndE-ValueType
IG_like 40 105 3.26e0 SMART
IG 129 315 1.37e-1 SMART
IG_like 237 302 2.2e-1 SMART
IG 328 415 6.31e-1 SMART
IG 430 519 8.01e-3 SMART
Predicted Effect probably null
Transcript: ENSMUST00000108619
AA Change: Y396*
SMART Domains Protein: ENSMUSP00000104259
Gene: ENSMUSG00000074419
AA Change: Y396*

DomainStartEndE-ValueType
IG_like 40 105 3.26e0 SMART
IG 129 315 1.37e-1 SMART
IG_like 237 302 2.2e-1 SMART
IG 328 415 6.31e-1 SMART
IG_like 429 517 6.02e0 SMART
IG 529 618 8.01e-3 SMART
low complexity region 637 646 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000108620
AA Change: Y396*
SMART Domains Protein: ENSMUSP00000104260
Gene: ENSMUSG00000074419
AA Change: Y396*

DomainStartEndE-ValueType
IG_like 40 105 3.26e0 SMART
IG 129 315 1.37e-1 SMART
IG_like 237 302 2.2e-1 SMART
IG 328 415 6.31e-1 SMART
IG 430 519 8.01e-3 SMART
low complexity region 538 547 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000153846
AA Change: Y396*
SMART Domains Protein: ENSMUSP00000121707
Gene: ENSMUSG00000074419
AA Change: Y396*

DomainStartEndE-ValueType
IG 7 96 8.01e-3 SMART
low complexity region 132 141 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000189095
AA Change: Y396*
SMART Domains Protein: ENSMUSP00000140974
Gene: ENSMUSG00000074419
AA Change: Y396*

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
IG_like 40 105 1.3e-2 SMART
IG 129 315 5.7e-4 SMART
IG_like 237 302 9e-4 SMART
IG 328 415 2.6e-3 SMART
IG_like 429 517 2.4e-2 SMART
IG 529 618 3.3e-5 SMART
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.7%
  • 20x: 94.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrb3 G T 1: 25,547,532 T360K probably damaging Het
AW551984 T C 9: 39,597,153 K356E probably benign Het
Bpifb2 T A 2: 153,881,193 V123E probably damaging Het
Cacna1a T G 8: 84,549,514 F532V probably damaging Het
Cct8 C A 16: 87,487,688 E204* probably null Het
Cd163 T A 6: 124,317,618 probably null Het
Cep152 C A 2: 125,587,948 A685S possibly damaging Het
Chdh A G 14: 30,036,841 D581G probably benign Het
Cnpy3 A C 17: 46,747,465 Y77* probably null Het
Col5a3 T C 9: 20,793,574 E762G unknown Het
Creb3 A G 4: 43,563,247 T115A probably benign Het
Dlat G T 9: 50,644,481 A412E probably benign Het
Dnah2 T C 11: 69,476,688 N1789S probably damaging Het
Dzank1 C T 2: 144,491,804 E370K probably benign Het
Eif3m A T 2: 105,006,839 probably null Het
Gimap8 A T 6: 48,658,986 M562L probably benign Het
Gprc6a T A 10: 51,631,457 probably benign Het
Gsr T G 8: 33,680,319 probably null Het
Gstcd A G 3: 132,983,099 V630A probably damaging Het
Hip1r T C 5: 123,989,980 I116T probably benign Het
Hivep3 A G 4: 120,131,803 E1817G probably damaging Het
Inpp5f A C 7: 128,663,725 T135P probably damaging Het
Ism2 A G 12: 87,285,027 silent Het
Itga11 A G 9: 62,765,788 D784G probably damaging Het
Itpr2 A G 6: 146,373,173 F837S probably damaging Het
Itpr2 T C 6: 146,396,958 E10G probably damaging Het
Knl1 A T 2: 119,069,137 K440* probably null Het
Lonp2 T C 8: 86,713,315 S648P probably damaging Het
Lrba T C 3: 86,359,868 S1622P probably benign Het
Lrp2 G T 2: 69,487,966 A2047D probably damaging Het
Mcm3 G A 1: 20,803,577 T773I probably benign Het
Mfsd7a T C 5: 108,442,079 T486A probably damaging Het
Mki67 A G 7: 135,695,469 V2612A probably benign Het
Mnx1 C A 5: 29,478,131 G49W probably damaging Het
Muc5b T A 7: 141,849,079 Y673* probably null Het
Myo15 A G 11: 60,479,930 H1172R probably benign Het
Myo1g T C 11: 6,516,080 K363R probably null Het
Ncoa4 T A 14: 32,176,641 C473S probably benign Het
Nefh T C 11: 4,939,656 T988A unknown Het
Nwd2 T A 5: 63,804,460 D462E probably benign Het
Olfr332 T C 11: 58,490,087 T223A probably benign Het
Plec T C 15: 76,181,067 E1466G unknown Het
Prl3d2 G T 13: 27,122,396 M35I probably benign Het
Reln T A 5: 22,152,463 I202F probably benign Het
Rhot1 T A 11: 80,225,602 D78E probably benign Het
Rsph3b T C 17: 6,905,129 probably null Het
Scn10a C T 9: 119,609,651 M1717I probably damaging Het
Sema6a T A 18: 47,249,296 H728L possibly damaging Het
Slc26a3 G T 12: 31,457,080 A345S possibly damaging Het
Slc35d2 A G 13: 64,099,283 V261A possibly damaging Het
Ssmem1 A G 6: 30,519,514 D66G probably damaging Het
Sult2a8 A T 7: 14,425,477 N72K probably benign Het
Tbx10 T C 19: 3,996,921 L108P probably damaging Het
Tex14 T C 11: 87,536,865 S48P probably damaging Het
Tmie A G 9: 110,867,528 L95P probably damaging Het
Tom1l2 C G 11: 60,270,433 R84P probably damaging Het
Trpm3 T A 19: 22,889,435 D543E possibly damaging Het
Vipr2 A C 12: 116,080,131 R49S probably benign Het
Vps8 A T 16: 21,442,439 S110C probably damaging Het
Zfp791 T A 8: 85,110,968 N89I probably damaging Het
Other mutations in Gm15448
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00434:Gm15448 APN 7 3823089 missense probably damaging 1.00
IGL01675:Gm15448 APN 7 3822608 splice site probably benign
IGL02040:Gm15448 APN 7 3821517 splice site probably benign
IGL02547:Gm15448 APN 7 3821661 missense probably damaging 0.98
IGL02749:Gm15448 APN 7 3822625 missense probably damaging 1.00
IGL02822:Gm15448 APN 7 3816918 missense possibly damaging 0.50
IGL02883:Gm15448 APN 7 3822180 missense possibly damaging 0.95
IGL03140:Gm15448 APN 7 3823248 missense probably benign 0.00
IGL03185:Gm15448 APN 7 3823230 missense probably damaging 1.00
IGL03212:Gm15448 APN 7 3823133 missense probably benign 0.00
R0347:Gm15448 UTSW 7 3822874 missense probably damaging 1.00
R0652:Gm15448 UTSW 7 3822763 missense probably benign 0.02
R0668:Gm15448 UTSW 7 3822700 missense probably damaging 0.99
R0724:Gm15448 UTSW 7 3816872 missense possibly damaging 0.83
R0735:Gm15448 UTSW 7 3821782 missense possibly damaging 0.79
R1074:Gm15448 UTSW 7 3823070 missense probably damaging 1.00
R1339:Gm15448 UTSW 7 3822156 missense probably damaging 1.00
R1541:Gm15448 UTSW 7 3816989 missense probably damaging 1.00
R1570:Gm15448 UTSW 7 3823061 missense probably benign 0.45
R1880:Gm15448 UTSW 7 3824951 critical splice donor site probably null
R1892:Gm15448 UTSW 7 3824574 missense probably benign 0.15
R1909:Gm15448 UTSW 7 3822919 missense probably benign 0.31
R2881:Gm15448 UTSW 7 3825641 start codon destroyed probably null 0.98
R2967:Gm15448 UTSW 7 3822687 missense probably damaging 1.00
R2983:Gm15448 UTSW 7 3821575 missense probably damaging 1.00
R4213:Gm15448 UTSW 7 3821554 missense probably damaging 1.00
R4319:Gm15448 UTSW 7 3822755 missense possibly damaging 0.46
R4320:Gm15448 UTSW 7 3822755 missense possibly damaging 0.46
R4321:Gm15448 UTSW 7 3822755 missense possibly damaging 0.46
R4322:Gm15448 UTSW 7 3822755 missense possibly damaging 0.46
R4323:Gm15448 UTSW 7 3822755 missense possibly damaging 0.46
R4536:Gm15448 UTSW 7 3822252 missense probably benign 0.00
R4597:Gm15448 UTSW 7 3822155 missense possibly damaging 0.81
R4725:Gm15448 UTSW 7 3821548 missense probably benign
R4934:Gm15448 UTSW 7 3822677 missense probably damaging 1.00
R4971:Gm15448 UTSW 7 3822806 missense probably benign 0.00
R5138:Gm15448 UTSW 7 3824557 nonsense probably null
R5805:Gm15448 UTSW 7 3822623 missense probably benign 0.15
R5824:Gm15448 UTSW 7 3824754 missense probably damaging 1.00
R5841:Gm15448 UTSW 7 3822899 nonsense probably null
R6027:Gm15448 UTSW 7 3824639 missense possibly damaging 0.94
R6214:Gm15448 UTSW 7 3821718 missense probably damaging 0.99
R6329:Gm15448 UTSW 7 3822851 missense probably damaging 1.00
R6429:Gm15448 UTSW 7 3822346 missense possibly damaging 0.63
R6650:Gm15448 UTSW 7 3816899 missense possibly damaging 0.83
R6681:Gm15448 UTSW 7 3822252 missense probably benign 0.00
R6961:Gm15448 UTSW 7 3825125 missense probably damaging 1.00
R6989:Gm15448 UTSW 7 3822164 missense possibly damaging 0.95
R7025:Gm15448 UTSW 7 3821262 nonsense probably null
R7071:Gm15448 UTSW 7 3821668 missense unknown
R7194:Gm15448 UTSW 7 3824793 missense
R7215:Gm15448 UTSW 7 3822311 missense unknown
R7580:Gm15448 UTSW 7 3824612 missense unknown
R7776:Gm15448 UTSW 7 3823247 missense unknown
R7863:Gm15448 UTSW 7 3824802 critical splice acceptor site probably null
R7909:Gm15448 UTSW 7 3821709 missense unknown
R8131:Gm15448 UTSW 7 3822162 nonsense probably null
R8178:Gm15448 UTSW 7 3821261 missense unknown
R8188:Gm15448 UTSW 7 3823127 missense unknown
R8220:Gm15448 UTSW 7 3822904 missense unknown
R8226:Gm15448 UTSW 7 3825110 missense
Predicted Primers PCR Primer
(F):5'- AACACAGGCTCTCCATTTTGTC -3'
(R):5'- AACTCAGACTGTCAGCACTG -3'

Sequencing Primer
(F):5'- GTCCTTCTCTACCTGCAACTCAG -3'
(R):5'- GAGGAAACATGACACTCCACTGTG -3'
Posted On2015-10-21