Incidental Mutation 'R4713:Inpp5f'
ID 353369
Institutional Source Beutler Lab
Gene Symbol Inpp5f
Ensembl Gene ENSMUSG00000042105
Gene Name inositol polyphosphate-5-phosphatase F
Synonyms cI-27, 5830435P03Rik, SAC2
MMRRC Submission 041601-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.312) question?
Stock # R4713 (G1)
Quality Score 225
Status Not validated
Chromosome 7
Chromosomal Location 128611328-128696425 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to C at 128663725 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Proline at position 135 (T135P)
Ref Sequence ENSEMBL: ENSMUSP00000045910 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043138]
AlphaFold Q8CDA1
Predicted Effect probably damaging
Transcript: ENSMUST00000043138
AA Change: T135P

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000045910
Gene: ENSMUSG00000042105
AA Change: T135P

DomainStartEndE-ValueType
Pfam:Syja_N 49 416 1.2e-85 PFAM
Blast:IPPc 449 568 6e-13 BLAST
Pfam:hSac2 590 698 9.1e-25 PFAM
low complexity region 1042 1054 N/A INTRINSIC
low complexity region 1059 1065 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000098007
SMART Domains Protein: ENSMUSP00000095616
Gene: ENSMUSG00000042105

DomainStartEndE-ValueType
Pfam:Syja_N 48 410 1.2e-79 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129085
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130789
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148815
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.7%
  • 20x: 94.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is an inositol 1,4,5-trisphosphate (InsP3) 5-phosphatase and contains a Sac domain. The activity of this protein is specific for phosphatidylinositol 4,5-bisphosphate and phosphatidylinositol 3,4,5-trisphosphate. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Aug 2011]
PHENOTYPE: Mice homozygous for a gene trap allele exhibit increased isoproterenol-induced cardiac hypertrophy. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrb3 G T 1: 25,547,532 T360K probably damaging Het
AW551984 T C 9: 39,597,153 K356E probably benign Het
Bpifb2 T A 2: 153,881,193 V123E probably damaging Het
Cacna1a T G 8: 84,549,514 F532V probably damaging Het
Cct8 C A 16: 87,487,688 E204* probably null Het
Cd163 T A 6: 124,317,618 probably null Het
Cep152 C A 2: 125,587,948 A685S possibly damaging Het
Chdh A G 14: 30,036,841 D581G probably benign Het
Cnpy3 A C 17: 46,747,465 Y77* probably null Het
Col5a3 T C 9: 20,793,574 E762G unknown Het
Creb3 A G 4: 43,563,247 T115A probably benign Het
Dlat G T 9: 50,644,481 A412E probably benign Het
Dnah2 T C 11: 69,476,688 N1789S probably damaging Het
Dzank1 C T 2: 144,491,804 E370K probably benign Het
Eif3m A T 2: 105,006,839 probably null Het
Gimap8 A T 6: 48,658,986 M562L probably benign Het
Gm15448 G T 7: 3,822,681 Y396* probably null Het
Gprc6a T A 10: 51,631,457 probably benign Het
Gsr T G 8: 33,680,319 probably null Het
Gstcd A G 3: 132,983,099 V630A probably damaging Het
Hip1r T C 5: 123,989,980 I116T probably benign Het
Hivep3 A G 4: 120,131,803 E1817G probably damaging Het
Ism2 A G 12: 87,285,027 silent Het
Itga11 A G 9: 62,765,788 D784G probably damaging Het
Itpr2 A G 6: 146,373,173 F837S probably damaging Het
Itpr2 T C 6: 146,396,958 E10G probably damaging Het
Knl1 A T 2: 119,069,137 K440* probably null Het
Lonp2 T C 8: 86,713,315 S648P probably damaging Het
Lrba T C 3: 86,359,868 S1622P probably benign Het
Lrp2 G T 2: 69,487,966 A2047D probably damaging Het
Mcm3 G A 1: 20,803,577 T773I probably benign Het
Mfsd7a T C 5: 108,442,079 T486A probably damaging Het
Mki67 A G 7: 135,695,469 V2612A probably benign Het
Mnx1 C A 5: 29,478,131 G49W probably damaging Het
Muc5b T A 7: 141,849,079 Y673* probably null Het
Myo15 A G 11: 60,479,930 H1172R probably benign Het
Myo1g T C 11: 6,516,080 K363R probably null Het
Ncoa4 T A 14: 32,176,641 C473S probably benign Het
Nefh T C 11: 4,939,656 T988A unknown Het
Nwd2 T A 5: 63,804,460 D462E probably benign Het
Olfr332 T C 11: 58,490,087 T223A probably benign Het
Plec T C 15: 76,181,067 E1466G unknown Het
Prl3d2 G T 13: 27,122,396 M35I probably benign Het
Reln T A 5: 22,152,463 I202F probably benign Het
Rhot1 T A 11: 80,225,602 D78E probably benign Het
Rsph3b T C 17: 6,905,129 probably null Het
Scn10a C T 9: 119,609,651 M1717I probably damaging Het
Sema6a T A 18: 47,249,296 H728L possibly damaging Het
Slc26a3 G T 12: 31,457,080 A345S possibly damaging Het
Slc35d2 A G 13: 64,099,283 V261A possibly damaging Het
Ssmem1 A G 6: 30,519,514 D66G probably damaging Het
Sult2a8 A T 7: 14,425,477 N72K probably benign Het
Tbx10 T C 19: 3,996,921 L108P probably damaging Het
Tex14 T C 11: 87,536,865 S48P probably damaging Het
Tmie A G 9: 110,867,528 L95P probably damaging Het
Tom1l2 C G 11: 60,270,433 R84P probably damaging Het
Trpm3 T A 19: 22,889,435 D543E possibly damaging Het
Vipr2 A C 12: 116,080,131 R49S probably benign Het
Vps8 A T 16: 21,442,439 S110C probably damaging Het
Zfp791 T A 8: 85,110,968 N89I probably damaging Het
Other mutations in Inpp5f
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00650:Inpp5f APN 7 128664267 missense probably benign 0.04
IGL01316:Inpp5f APN 7 128690706 splice site probably benign
IGL01455:Inpp5f APN 7 128678049 missense probably damaging 1.00
IGL01471:Inpp5f APN 7 128675398 missense probably damaging 0.99
IGL01590:Inpp5f APN 7 128664307 critical splice donor site probably null
IGL01942:Inpp5f APN 7 128667769 missense probably damaging 1.00
IGL02092:Inpp5f APN 7 128685224 missense probably damaging 1.00
IGL02137:Inpp5f APN 7 128695129 missense probably damaging 1.00
IGL02664:Inpp5f APN 7 128664014 missense probably damaging 1.00
IGL02812:Inpp5f APN 7 128682306 missense probably damaging 1.00
IGL02942:Inpp5f APN 7 128694900 missense probably benign 0.29
PIT4480001:Inpp5f UTSW 7 128685134 missense probably benign 0.32
PIT4812001:Inpp5f UTSW 7 128692308 missense probably benign 0.39
R0243:Inpp5f UTSW 7 128695183 missense probably damaging 1.00
R0346:Inpp5f UTSW 7 128690668 missense probably damaging 1.00
R1186:Inpp5f UTSW 7 128694583 missense probably benign
R1375:Inpp5f UTSW 7 128664029 nonsense probably null
R1918:Inpp5f UTSW 7 128663969 splice site probably benign
R2307:Inpp5f UTSW 7 128694310 missense probably damaging 1.00
R3716:Inpp5f UTSW 7 128690670 missense probably damaging 1.00
R4157:Inpp5f UTSW 7 128679699 intron probably benign
R4647:Inpp5f UTSW 7 128659109 missense possibly damaging 0.94
R4705:Inpp5f UTSW 7 128663987 missense probably damaging 0.97
R4818:Inpp5f UTSW 7 128685129 missense probably damaging 1.00
R4914:Inpp5f UTSW 7 128685116 missense probably damaging 1.00
R4915:Inpp5f UTSW 7 128685116 missense probably damaging 1.00
R4917:Inpp5f UTSW 7 128685116 missense probably damaging 1.00
R5069:Inpp5f UTSW 7 128676727 critical splice acceptor site probably null
R5181:Inpp5f UTSW 7 128679831 missense probably damaging 1.00
R5234:Inpp5f UTSW 7 128663683 missense probably benign
R6299:Inpp5f UTSW 7 128636160 missense possibly damaging 0.87
R6389:Inpp5f UTSW 7 128678056 missense probably damaging 1.00
R6530:Inpp5f UTSW 7 128664078 nonsense probably null
R6545:Inpp5f UTSW 7 128694556 missense possibly damaging 0.88
R7259:Inpp5f UTSW 7 128669957 missense probably benign 0.00
R7383:Inpp5f UTSW 7 128694586 missense probably damaging 1.00
R7427:Inpp5f UTSW 7 128679805 missense probably damaging 1.00
R7428:Inpp5f UTSW 7 128679805 missense probably damaging 1.00
R7679:Inpp5f UTSW 7 128694523 missense possibly damaging 0.68
R7809:Inpp5f UTSW 7 128667643 missense probably damaging 1.00
R7840:Inpp5f UTSW 7 128694802 missense probably benign
R7912:Inpp5f UTSW 7 128692313 missense probably benign
R7915:Inpp5f UTSW 7 128667709 missense probably benign 0.25
R7960:Inpp5f UTSW 7 128693914 splice site probably null
R8027:Inpp5f UTSW 7 128690673 missense probably damaging 1.00
R8154:Inpp5f UTSW 7 128664267 missense possibly damaging 0.73
R8213:Inpp5f UTSW 7 128679805 missense probably damaging 1.00
R9499:Inpp5f UTSW 7 128693713 missense possibly damaging 0.62
R9519:Inpp5f UTSW 7 128676791 missense possibly damaging 0.62
R9544:Inpp5f UTSW 7 128676791 missense possibly damaging 0.62
R9597:Inpp5f UTSW 7 128676791 missense possibly damaging 0.62
R9598:Inpp5f UTSW 7 128676791 missense possibly damaging 0.62
R9634:Inpp5f UTSW 7 128676791 missense possibly damaging 0.62
R9701:Inpp5f UTSW 7 128676791 missense possibly damaging 0.62
R9702:Inpp5f UTSW 7 128676791 missense possibly damaging 0.62
R9784:Inpp5f UTSW 7 128676791 missense possibly damaging 0.62
R9802:Inpp5f UTSW 7 128676791 missense possibly damaging 0.62
R9803:Inpp5f UTSW 7 128676791 missense possibly damaging 0.62
RF001:Inpp5f UTSW 7 128695083 missense probably damaging 1.00
X0061:Inpp5f UTSW 7 128682297 missense probably damaging 1.00
Z1088:Inpp5f UTSW 7 128694949 missense probably benign 0.17
Predicted Primers PCR Primer
(F):5'- GGGTCTACTTTTAACCCAAATGC -3'
(R):5'- AGCAAGCCTTCAAGTTAGGAC -3'

Sequencing Primer
(F):5'- TGCCCAAGCAGTAGTGTTCAC -3'
(R):5'- GCCTTCAAGTTAGGACAATCCC -3'
Posted On 2015-10-21