Mutagenetix > Incidental Mutations

Incidental Mutation 'R4713:Mki67'

353370

Institutional Source

Beutler Lab

Gene Symbol

Mki67

Ensembl Gene

ENSMUSG00000031004

Gene Name

antigen identified by monoclonal antibody Ki 67

Synonyms

D630048A14Rik, Ki-67, Ki67

MMRRC Submission

041601-MU

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.819) question?

Stock #

R4713 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

135689784-135716361 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 135695469 bp

Zygosity

Heterozygous

Amino Acid Change

Valine to Alanine at position 2612 (V2612A)

Ref Sequence

ENSEMBL: ENSMUSP00000033310 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000033310]

Predicted Effect

probably benign
Transcript: ENSMUST00000033310
AA Change: V2612A

PolyPhen 2 Score 0.353 (Sensitivity: 0.90; Specificity: 0.89)

SMART Domains

Protein: ENSMUSP00000033310
Gene: ENSMUSG00000031004
AA Change: V2612A

Domain	Start	End	E-Value	Type
FHA	26	76	1.03e-11	SMART
Pfam:PP1_bind	462	519	2.8e-20	PFAM
low complexity region	535	545	N/A	INTRINSIC
low complexity region	869	882	N/A	INTRINSIC
Pfam:K167R	889	982	1.5e-9	PFAM
K167R	993	1102	2.01e-39	SMART
K167R	1107	1217	1.87e-57	SMART
K167R	1228	1337	1.33e-53	SMART
K167R	1348	1451	6.57e-44	SMART
K167R	1462	1570	9.09e-38	SMART
K167R	1580	1686	5.02e-40	SMART
K167R	1697	1807	9.6e-37	SMART
K167R	1818	1926	5.94e-51	SMART
K167R	1937	2047	1.6e-56	SMART
K167R	2058	2164	4.04e-53	SMART
K167R	2175	2285	1.52e-57	SMART
K167R	2296	2407	1.78e-40	SMART
K167R	2418	2527	1.71e-42	SMART
K167R	2538	2640	7.41e-20	SMART
K167R	2642	2750	1.06e-38	SMART
K167R	2761	2872	2.1e-42	SMART

Coding Region Coverage

1x: 99.1%
3x: 98.5%
10x: 96.7%
20x: 94.0%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a nuclear protein that is associated with and may be necessary for cellular proliferation. Alternatively spliced transcript variants have been described. A related pseudogene exists on chromosome X. [provided by RefSeq, Mar 2009]
PHENOTYPE: Mice carrying a reporter allele show expression in actively dividing cells. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 60 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adgrb3	G	T	1: 25,547,532	T360K	probably damaging	Het
AW551984	T	C	9: 39,597,153	K356E	probably benign	Het
Bpifb2	T	A	2: 153,881,193	V123E	probably damaging	Het
Cacna1a	T	G	8: 84,549,514	F532V	probably damaging	Het
Cct8	C	A	16: 87,487,688	E204*	probably null	Het
Cd163	T	A	6: 124,317,618		probably null	Het
Cep152	C	A	2: 125,587,948	A685S	possibly damaging	Het
Chdh	A	G	14: 30,036,841	D581G	probably benign	Het
Cnpy3	A	C	17: 46,747,465	Y77*	probably null	Het
Col5a3	T	C	9: 20,793,574	E762G	unknown	Het
Creb3	A	G	4: 43,563,247	T115A	probably benign	Het
Dlat	G	T	9: 50,644,481	A412E	probably benign	Het
Dnah2	T	C	11: 69,476,688	N1789S	probably damaging	Het
Dzank1	C	T	2: 144,491,804	E370K	probably benign	Het
Eif3m	A	T	2: 105,006,839		probably null	Het
Gimap8	A	T	6: 48,658,986	M562L	probably benign	Het
Gm15448	G	T	7: 3,822,681	Y396*	probably null	Het
Gprc6a	T	A	10: 51,631,457		probably benign	Het
Gsr	T	G	8: 33,680,319		probably null	Het
Gstcd	A	G	3: 132,983,099	V630A	probably damaging	Het
Hip1r	T	C	5: 123,989,980	I116T	probably benign	Het
Hivep3	A	G	4: 120,131,803	E1817G	probably damaging	Het
Inpp5f	A	C	7: 128,663,725	T135P	probably damaging	Het
Ism2	A	G	12: 87,285,027		silent	Het
Itga11	A	G	9: 62,765,788	D784G	probably damaging	Het
Itpr2	A	G	6: 146,373,173	F837S	probably damaging	Het
Itpr2	T	C	6: 146,396,958	E10G	probably damaging	Het
Knl1	A	T	2: 119,069,137	K440*	probably null	Het
Lonp2	T	C	8: 86,713,315	S648P	probably damaging	Het
Lrba	T	C	3: 86,359,868	S1622P	probably benign	Het
Lrp2	G	T	2: 69,487,966	A2047D	probably damaging	Het
Mcm3	G	A	1: 20,803,577	T773I	probably benign	Het
Mfsd7a	T	C	5: 108,442,079	T486A	probably damaging	Het
Mnx1	C	A	5: 29,478,131	G49W	probably damaging	Het
Muc5b	T	A	7: 141,849,079	Y673*	probably null	Het
Myo15	A	G	11: 60,479,930	H1172R	probably benign	Het
Myo1g	T	C	11: 6,516,080	K363R	probably null	Het
Ncoa4	T	A	14: 32,176,641	C473S	probably benign	Het
Nefh	T	C	11: 4,939,656	T988A	unknown	Het
Nwd2	T	A	5: 63,804,460	D462E	probably benign	Het
Olfr332	T	C	11: 58,490,087	T223A	probably benign	Het
Plec	T	C	15: 76,181,067	E1466G	unknown	Het
Prl3d2	G	T	13: 27,122,396	M35I	probably benign	Het
Reln	T	A	5: 22,152,463	I202F	probably benign	Het
Rhot1	T	A	11: 80,225,602	D78E	probably benign	Het
Rsph3b	T	C	17: 6,905,129		probably null	Het
Scn10a	C	T	9: 119,609,651	M1717I	probably damaging	Het
Sema6a	T	A	18: 47,249,296	H728L	possibly damaging	Het
Slc26a3	G	T	12: 31,457,080	A345S	possibly damaging	Het
Slc35d2	A	G	13: 64,099,283	V261A	possibly damaging	Het
Ssmem1	A	G	6: 30,519,514	D66G	probably damaging	Het
Sult2a8	A	T	7: 14,425,477	N72K	probably benign	Het
Tbx10	T	C	19: 3,996,921	L108P	probably damaging	Het
Tex14	T	C	11: 87,536,865	S48P	probably damaging	Het
Tmie	A	G	9: 110,867,528	L95P	probably damaging	Het
Tom1l2	C	G	11: 60,270,433	R84P	probably damaging	Het
Trpm3	T	A	19: 22,889,435	D543E	possibly damaging	Het
Vipr2	A	C	12: 116,080,131	R49S	probably benign	Het
Vps8	A	T	16: 21,442,439	S110C	probably damaging	Het
Zfp791	T	A	8: 85,110,968	N89I	probably damaging	Het

Other mutations in Mki67

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00225:Mki67	APN	7	135690120	missense	probably benign	0.32
IGL00264:Mki67	APN	7	135707820	nonsense	probably null
IGL00328:Mki67	APN	7	135696695	missense	probably benign	0.03
IGL00570:Mki67	APN	7	135708101	missense	possibly damaging	0.88
IGL00584:Mki67	APN	7	135695695	missense	probably damaging	1.00
IGL00756:Mki67	APN	7	135698731	missense	possibly damaging	0.76
IGL01063:Mki67	APN	7	135694922	missense	possibly damaging	0.93
IGL01112:Mki67	APN	7	135714016	missense	probably damaging	1.00
IGL01360:Mki67	APN	7	135705776	missense	probably damaging	1.00
IGL01457:Mki67	APN	7	135699546	missense	probably benign	0.00
IGL01686:Mki67	APN	7	135707813	missense	probably benign	0.00
IGL01731:Mki67	APN	7	135696549	missense	probably benign	0.03
IGL01775:Mki67	APN	7	135698276	missense	possibly damaging	0.71
IGL01806:Mki67	APN	7	135698957	missense	probably damaging	0.98
IGL01860:Mki67	APN	7	135698957	missense	probably damaging	0.98
IGL01938:Mki67	APN	7	135694330	missense	probably benign	0.04
IGL02249:Mki67	APN	7	135700522	missense	possibly damaging	0.47
IGL02260:Mki67	APN	7	135701968	missense	probably benign	0.00
IGL02270:Mki67	APN	7	135698632	missense	probably damaging	1.00
IGL02406:Mki67	APN	7	135698793	missense	probably benign	0.00
IGL02499:Mki67	APN	7	135694327	missense	possibly damaging	0.94
IGL02655:Mki67	APN	7	135714019	missense	probably damaging	0.98
IGL02700:Mki67	APN	7	135708202	missense	probably benign	0.02
IGL03370:Mki67	APN	7	135695490	missense	probably benign	0.00
PIT4468001:Mki67	UTSW	7	135699147	missense	probably benign	0.00
R0001:Mki67	UTSW	7	135699172	missense	probably damaging	1.00
R0001:Mki67	UTSW	7	135701019	missense	probably damaging	0.99
R0043:Mki67	UTSW	7	135700581	missense	probably benign	0.16
R0043:Mki67	UTSW	7	135700581	missense	probably benign	0.16
R0102:Mki67	UTSW	7	135713803	missense	probably benign	0.16
R0130:Mki67	UTSW	7	135696459	missense	probably damaging	1.00
R0149:Mki67	UTSW	7	135698424	missense	probably benign	0.00
R0356:Mki67	UTSW	7	135704406	missense	probably benign	0.34
R0482:Mki67	UTSW	7	135699429	missense	possibly damaging	0.60
R0508:Mki67	UTSW	7	135700346	missense	probably benign
R0532:Mki67	UTSW	7	135698164	nonsense	probably null
R0548:Mki67	UTSW	7	135695256	missense	probably damaging	1.00
R0548:Mki67	UTSW	7	135696908	missense	possibly damaging	0.82
R0557:Mki67	UTSW	7	135699261	missense	possibly damaging	0.48
R0627:Mki67	UTSW	7	135708258	missense	probably benign	0.31
R0631:Mki67	UTSW	7	135704388	missense	probably damaging	0.98
R0848:Mki67	UTSW	7	135701043	missense	probably benign	0.21
R1075:Mki67	UTSW	7	135697311	missense	probably benign	0.03
R1105:Mki67	UTSW	7	135701050	missense	probably benign	0.09
R1272:Mki67	UTSW	7	135700414	nonsense	probably null
R1331:Mki67	UTSW	7	135698276	missense	possibly damaging	0.71
R1486:Mki67	UTSW	7	135699720	missense	probably benign	0.00
R1510:Mki67	UTSW	7	135696171	missense	probably benign	0.26
R1573:Mki67	UTSW	7	135695116	missense	possibly damaging	0.93
R1586:Mki67	UTSW	7	135713972	nonsense	probably null
R1599:Mki67	UTSW	7	135699934	missense	probably benign	0.34
R1623:Mki67	UTSW	7	135708818	splice site	probably null
R1706:Mki67	UTSW	7	135700566	missense	probably benign	0.37
R1718:Mki67	UTSW	7	135695494	missense	probably damaging	1.00
R1785:Mki67	UTSW	7	135704241	critical splice acceptor site	probably null
R1816:Mki67	UTSW	7	135707387	missense	possibly damaging	0.68
R1862:Mki67	UTSW	7	135699361	missense	probably benign	0.09
R1929:Mki67	UTSW	7	135698065	missense	possibly damaging	0.46
R1957:Mki67	UTSW	7	135698399	missense	probably benign	0.01
R1971:Mki67	UTSW	7	135713959	critical splice donor site	probably null
R1998:Mki67	UTSW	7	135705770	missense	probably benign	0.00
R2004:Mki67	UTSW	7	135698509	nonsense	probably null
R2005:Mki67	UTSW	7	135698509	nonsense	probably null
R2006:Mki67	UTSW	7	135698509	nonsense	probably null
R2109:Mki67	UTSW	7	135697863	missense	probably damaging	1.00
R2130:Mki67	UTSW	7	135704241	critical splice acceptor site	probably null
R2131:Mki67	UTSW	7	135704241	critical splice acceptor site	probably null
R2133:Mki67	UTSW	7	135704241	critical splice acceptor site	probably null
R2140:Mki67	UTSW	7	135695592	missense	possibly damaging	0.94
R2141:Mki67	UTSW	7	135695592	missense	possibly damaging	0.94
R2142:Mki67	UTSW	7	135695592	missense	possibly damaging	0.94
R2284:Mki67	UTSW	7	135699945	missense	probably damaging	0.99
R2869:Mki67	UTSW	7	135708149	missense	probably benign	0.19
R2869:Mki67	UTSW	7	135708149	missense	probably benign	0.19
R2871:Mki67	UTSW	7	135708149	missense	probably benign	0.19
R2871:Mki67	UTSW	7	135708149	missense	probably benign	0.19
R2913:Mki67	UTSW	7	135700686	missense	possibly damaging	0.71
R3404:Mki67	UTSW	7	135707475	missense	probably benign	0.01
R3405:Mki67	UTSW	7	135707475	missense	probably benign	0.01
R3406:Mki67	UTSW	7	135707475	missense	probably benign	0.01
R3777:Mki67	UTSW	7	135696130	missense	probably benign	0.10
R3778:Mki67	UTSW	7	135696130	missense	probably benign	0.10
R3787:Mki67	UTSW	7	135700283	missense	possibly damaging	0.93
R3847:Mki67	UTSW	7	135696130	missense	probably benign	0.10
R3848:Mki67	UTSW	7	135696130	missense	probably benign	0.10
R3853:Mki67	UTSW	7	135696130	missense	probably benign	0.10
R3971:Mki67	UTSW	7	135696130	missense	probably benign	0.10
R3972:Mki67	UTSW	7	135696130	missense	probably benign	0.10
R4258:Mki67	UTSW	7	135695288	missense	possibly damaging	0.86
R4343:Mki67	UTSW	7	135695118	missense	probably benign	0.10
R4488:Mki67	UTSW	7	135697671	missense	probably benign	0.01
R4528:Mki67	UTSW	7	135695359	missense	probably damaging	1.00
R4867:Mki67	UTSW	7	135699856	missense	probably damaging	0.97
R4874:Mki67	UTSW	7	135708771	missense	probably damaging	0.97
R4897:Mki67	UTSW	7	135696745	missense	probably damaging	1.00
R5045:Mki67	UTSW	7	135707904	missense	possibly damaging	0.84
R5306:Mki67	UTSW	7	135714001	missense	probably damaging	1.00
R5309:Mki67	UTSW	7	135700830	missense	probably damaging	1.00
R5312:Mki67	UTSW	7	135700830	missense	probably damaging	1.00
R5379:Mki67	UTSW	7	135697461	missense	possibly damaging	0.95
R5506:Mki67	UTSW	7	135699981	missense	possibly damaging	0.60
R5513:Mki67	UTSW	7	135707750	missense	probably damaging	0.98
R5742:Mki67	UTSW	7	135704373	missense	probably benign	0.20
R5806:Mki67	UTSW	7	135704605	missense	probably damaging	1.00
R6008:Mki67	UTSW	7	135697429	missense	probably damaging	1.00
R6037:Mki67	UTSW	7	135696803	missense	possibly damaging	0.69
R6037:Mki67	UTSW	7	135696803	missense	possibly damaging	0.69
R6221:Mki67	UTSW	7	135697914	missense	probably benign	0.18
R6294:Mki67	UTSW	7	135704590	missense	probably benign	0.09
R6377:Mki67	UTSW	7	135696321	missense	possibly damaging	0.67
R6456:Mki67	UTSW	7	135699475	missense	possibly damaging	0.59
R6608:Mki67	UTSW	7	135698361	missense	probably benign	0.01
R6609:Mki67	UTSW	7	135699829	missense	possibly damaging	0.94
R6648:Mki67	UTSW	7	135697440	missense	probably damaging	1.00
R6901:Mki67	UTSW	7	135708760	splice site	probably null
R6978:Mki67	UTSW	7	135701962	missense	probably benign	0.10
R6985:Mki67	UTSW	7	135713865	missense	probably damaging	1.00
R7076:Mki67	UTSW	7	135705629	missense	probably damaging	0.98
R7217:Mki67	UTSW	7	135704182	missense	probably damaging	1.00
R7239:Mki67	UTSW	7	135700176	missense	possibly damaging	0.91
R7250:Mki67	UTSW	7	135699324	missense	possibly damaging	0.90
R7313:Mki67	UTSW	7	135694671	missense	probably benign	0.29
R7336:Mki67	UTSW	7	135713839	missense	probably benign	0.03
R7422:Mki67	UTSW	7	135698370	missense	probably damaging	1.00
R7451:Mki67	UTSW	7	135699351	missense	probably benign	0.01
R7502:Mki67	UTSW	7	135700783	missense	possibly damaging	0.53
R7513:Mki67	UTSW	7	135693223	missense	probably benign
R7578:Mki67	UTSW	7	135700915	missense	possibly damaging	0.68
R7619:Mki67	UTSW	7	135699377	missense	probably benign	0.01
R7646:Mki67	UTSW	7	135696769	missense	possibly damaging	0.63
R7659:Mki67	UTSW	7	135697426	missense	probably damaging	1.00
R7691:Mki67	UTSW	7	135701992	missense	not run
R7780:Mki67	UTSW	7	135713968	missense	probably benign	0.02
R7796:Mki67	UTSW	7	135698194	missense	probably damaging	1.00
X0020:Mki67	UTSW	7	135714001	missense	probably damaging	0.96
X0065:Mki67	UTSW	7	135713844	missense	possibly damaging	0.95

Predicted Primers

PCR Primer
(F):5'- AGTTGTATTCTGAGCTGCCTC -3'
(R):5'- TGTTGAGAAAACCCCAAAGATGC -3'

Sequencing Primer
(F):5'- GAGCTGCCTCTTTAAACCTGCTAAG -3'
(R):5'- GACAAATCTCCAGAACCTGTGG -3'

Posted On

2015-10-21