Incidental Mutation 'R4713:Gsr'
ID353372
Institutional Source Beutler Lab
Gene Symbol Gsr
Ensembl Gene ENSMUSG00000031584
Gene Nameglutathione reductase
SynonymsD8Ertd238e, Gr-1, Gr1
MMRRC Submission 041601-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.108) question?
Stock #R4713 (G1)
Quality Score215
Status Not validated
Chromosome8
Chromosomal Location33652523-33698163 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to G at 33680319 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000033992 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033992]
Predicted Effect probably null
Transcript: ENSMUST00000033992
SMART Domains Protein: ENSMUSP00000033992
Gene: ENSMUSG00000031584

DomainStartEndE-ValueType
low complexity region 17 22 N/A INTRINSIC
Pfam:Pyr_redox_2 43 368 1.2e-73 PFAM
Pfam:Pyr_redox 211 292 1.7e-21 PFAM
Pfam:Pyr_redox_dim 389 500 1.6e-38 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149528
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.7%
  • 20x: 94.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the class-I pyridine nucleotide-disulfide oxidoreductase family. This enzyme is a homodimeric flavoprotein. It is a central enzyme of cellular antioxidant defense, and reduces oxidized glutathione disulfide (GSSG) to the sulfhydryl form GSH, which is an important cellular antioxidant. Rare mutations in this gene result in hereditary glutathione reductase deficiency. Multiple alternatively spliced transcript variants encoding different isoforms have been found. [provided by RefSeq, Aug 2010]
PHENOTYPE: A homozygous mutation disrupting this gene between exon 1-2 results in a decreased retinal artery-to-vein ratio. Another small deletion of exons 2-5 has no phenotypic effect. Electrophoretic alleles designated a (C57BL/6, CE) vs. allele b (SJL, SWR) are known. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrb3 G T 1: 25,547,532 T360K probably damaging Het
AW551984 T C 9: 39,597,153 K356E probably benign Het
Bpifb2 T A 2: 153,881,193 V123E probably damaging Het
Cacna1a T G 8: 84,549,514 F532V probably damaging Het
Cct8 C A 16: 87,487,688 E204* probably null Het
Cd163 T A 6: 124,317,618 probably null Het
Cep152 C A 2: 125,587,948 A685S possibly damaging Het
Chdh A G 14: 30,036,841 D581G probably benign Het
Cnpy3 A C 17: 46,747,465 Y77* probably null Het
Col5a3 T C 9: 20,793,574 E762G unknown Het
Creb3 A G 4: 43,563,247 T115A probably benign Het
Dlat G T 9: 50,644,481 A412E probably benign Het
Dnah2 T C 11: 69,476,688 N1789S probably damaging Het
Dzank1 C T 2: 144,491,804 E370K probably benign Het
Eif3m A T 2: 105,006,839 probably null Het
Gimap8 A T 6: 48,658,986 M562L probably benign Het
Gm15448 G T 7: 3,822,681 Y396* probably null Het
Gprc6a T A 10: 51,631,457 probably benign Het
Gstcd A G 3: 132,983,099 V630A probably damaging Het
Hip1r T C 5: 123,989,980 I116T probably benign Het
Hivep3 A G 4: 120,131,803 E1817G probably damaging Het
Inpp5f A C 7: 128,663,725 T135P probably damaging Het
Ism2 A G 12: 87,285,027 silent Het
Itga11 A G 9: 62,765,788 D784G probably damaging Het
Itpr2 A G 6: 146,373,173 F837S probably damaging Het
Itpr2 T C 6: 146,396,958 E10G probably damaging Het
Knl1 A T 2: 119,069,137 K440* probably null Het
Lonp2 T C 8: 86,713,315 S648P probably damaging Het
Lrba T C 3: 86,359,868 S1622P probably benign Het
Lrp2 G T 2: 69,487,966 A2047D probably damaging Het
Mcm3 G A 1: 20,803,577 T773I probably benign Het
Mfsd7a T C 5: 108,442,079 T486A probably damaging Het
Mki67 A G 7: 135,695,469 V2612A probably benign Het
Mnx1 C A 5: 29,478,131 G49W probably damaging Het
Muc5b T A 7: 141,849,079 Y673* probably null Het
Myo15 A G 11: 60,479,930 H1172R probably benign Het
Myo1g T C 11: 6,516,080 K363R probably null Het
Ncoa4 T A 14: 32,176,641 C473S probably benign Het
Nefh T C 11: 4,939,656 T988A unknown Het
Nwd2 T A 5: 63,804,460 D462E probably benign Het
Olfr332 T C 11: 58,490,087 T223A probably benign Het
Plec T C 15: 76,181,067 E1466G unknown Het
Prl3d2 G T 13: 27,122,396 M35I probably benign Het
Reln T A 5: 22,152,463 I202F probably benign Het
Rhot1 T A 11: 80,225,602 D78E probably benign Het
Rsph3b T C 17: 6,905,129 probably null Het
Scn10a C T 9: 119,609,651 M1717I probably damaging Het
Sema6a T A 18: 47,249,296 H728L possibly damaging Het
Slc26a3 G T 12: 31,457,080 A345S possibly damaging Het
Slc35d2 A G 13: 64,099,283 V261A possibly damaging Het
Ssmem1 A G 6: 30,519,514 D66G probably damaging Het
Sult2a8 A T 7: 14,425,477 N72K probably benign Het
Tbx10 T C 19: 3,996,921 L108P probably damaging Het
Tex14 T C 11: 87,536,865 S48P probably damaging Het
Tmie A G 9: 110,867,528 L95P probably damaging Het
Tom1l2 C G 11: 60,270,433 R84P probably damaging Het
Trpm3 T A 19: 22,889,435 D543E possibly damaging Het
Vipr2 A C 12: 116,080,131 R49S probably benign Het
Vps8 A T 16: 21,442,439 S110C probably damaging Het
Zfp791 T A 8: 85,110,968 N89I probably damaging Het
Other mutations in Gsr
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02471:Gsr APN 8 33682584 splice site probably benign
IGL02481:Gsr APN 8 33685541 splice site probably benign
IGL02941:Gsr APN 8 33689425 missense probably damaging 0.98
IGL03242:Gsr APN 8 33685599 missense probably benign
IGL03293:Gsr APN 8 33694996 splice site probably benign
R0208:Gsr UTSW 8 33689355 missense possibly damaging 0.45
R0490:Gsr UTSW 8 33671512 splice site probably benign
R0492:Gsr UTSW 8 33681575 splice site probably benign
R0524:Gsr UTSW 8 33669180 critical splice donor site probably null
R1104:Gsr UTSW 8 33669921 missense probably damaging 1.00
R1976:Gsr UTSW 8 33680260 splice site probably null
R2507:Gsr UTSW 8 33680288 missense probably benign 0.45
R2508:Gsr UTSW 8 33680288 missense probably benign 0.45
R3726:Gsr UTSW 8 33671537 missense probably benign 0.11
R4573:Gsr UTSW 8 33693853 missense probably benign 0.00
R4623:Gsr UTSW 8 33680305 missense probably damaging 0.99
R4639:Gsr UTSW 8 33697256 missense probably damaging 1.00
R4717:Gsr UTSW 8 33693858 nonsense probably null
R4992:Gsr UTSW 8 33693913 missense probably damaging 1.00
R5099:Gsr UTSW 8 33671528 missense probably damaging 1.00
R6019:Gsr UTSW 8 33693807 missense probably damaging 0.97
R7046:Gsr UTSW 8 33695062 missense probably damaging 1.00
R7570:Gsr UTSW 8 33669165 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACAGTGCATTTTCTGAGAGTTG -3'
(R):5'- ACTGTCTGGGTGCTCACTTG -3'

Sequencing Primer
(F):5'- GTTCTGGCTAAACATGACCGC -3'
(R):5'- GGTGCTCACTTGCATCACC -3'
Posted On2015-10-21