Incidental Mutation 'R4713:Zfp791'
ID 353374
Institutional Source Beutler Lab
Gene Symbol Zfp791
Ensembl Gene ENSMUSG00000074194
Gene Name zinc finger protein 791
Synonyms EG244556
MMRRC Submission 041601-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R4713 (G1)
Quality Score 225
Status Not validated
Chromosome 8
Chromosomal Location 85108553-85123095 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 85110968 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Asparagine to Isoleucine at position 89 (N89I)
Ref Sequence ENSEMBL: ENSMUSP00000147335 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000098550] [ENSMUST00000211109]
AlphaFold Q497V9
Predicted Effect probably damaging
Transcript: ENSMUST00000098550
AA Change: N89I

PolyPhen 2 Score 0.980 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000096150
Gene: ENSMUSG00000074194
AA Change: N89I

DomainStartEndE-ValueType
KRAB 4 64 4.26e-18 SMART
ZnF_C2H2 102 124 2.53e-2 SMART
ZnF_C2H2 139 161 7.78e-3 SMART
ZnF_C2H2 167 189 3.34e-2 SMART
ZnF_C2H2 195 217 2.79e-4 SMART
ZnF_C2H2 223 245 6.78e-3 SMART
ZnF_C2H2 251 273 2.12e-4 SMART
ZnF_C2H2 281 303 2.02e-1 SMART
ZnF_C2H2 309 331 7.78e-3 SMART
ZnF_C2H2 337 359 6.42e-4 SMART
ZnF_C2H2 365 387 2.29e0 SMART
ZnF_C2H2 393 415 1.13e-4 SMART
ZnF_C2H2 421 443 2.75e-3 SMART
ZnF_C2H2 449 471 2.05e-2 SMART
ZnF_C2H2 477 499 3.95e-4 SMART
ZnF_C2H2 505 527 2.71e-2 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000158588
Predicted Effect probably damaging
Transcript: ENSMUST00000211109
AA Change: N89I

PolyPhen 2 Score 0.980 (Sensitivity: 0.75; Specificity: 0.96)
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.7%
  • 20x: 94.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrb3 G T 1: 25,547,532 T360K probably damaging Het
AW551984 T C 9: 39,597,153 K356E probably benign Het
Bpifb2 T A 2: 153,881,193 V123E probably damaging Het
Cacna1a T G 8: 84,549,514 F532V probably damaging Het
Cct8 C A 16: 87,487,688 E204* probably null Het
Cd163 T A 6: 124,317,618 probably null Het
Cep152 C A 2: 125,587,948 A685S possibly damaging Het
Chdh A G 14: 30,036,841 D581G probably benign Het
Cnpy3 A C 17: 46,747,465 Y77* probably null Het
Col5a3 T C 9: 20,793,574 E762G unknown Het
Creb3 A G 4: 43,563,247 T115A probably benign Het
Dlat G T 9: 50,644,481 A412E probably benign Het
Dnah2 T C 11: 69,476,688 N1789S probably damaging Het
Dzank1 C T 2: 144,491,804 E370K probably benign Het
Eif3m A T 2: 105,006,839 probably null Het
Gimap8 A T 6: 48,658,986 M562L probably benign Het
Gm15448 G T 7: 3,822,681 Y396* probably null Het
Gprc6a T A 10: 51,631,457 probably benign Het
Gsr T G 8: 33,680,319 probably null Het
Gstcd A G 3: 132,983,099 V630A probably damaging Het
Hip1r T C 5: 123,989,980 I116T probably benign Het
Hivep3 A G 4: 120,131,803 E1817G probably damaging Het
Inpp5f A C 7: 128,663,725 T135P probably damaging Het
Ism2 A G 12: 87,285,027 silent Het
Itga11 A G 9: 62,765,788 D784G probably damaging Het
Itpr2 A G 6: 146,373,173 F837S probably damaging Het
Itpr2 T C 6: 146,396,958 E10G probably damaging Het
Knl1 A T 2: 119,069,137 K440* probably null Het
Lonp2 T C 8: 86,713,315 S648P probably damaging Het
Lrba T C 3: 86,359,868 S1622P probably benign Het
Lrp2 G T 2: 69,487,966 A2047D probably damaging Het
Mcm3 G A 1: 20,803,577 T773I probably benign Het
Mfsd7a T C 5: 108,442,079 T486A probably damaging Het
Mki67 A G 7: 135,695,469 V2612A probably benign Het
Mnx1 C A 5: 29,478,131 G49W probably damaging Het
Muc5b T A 7: 141,849,079 Y673* probably null Het
Myo15 A G 11: 60,479,930 H1172R probably benign Het
Myo1g T C 11: 6,516,080 K363R probably null Het
Ncoa4 T A 14: 32,176,641 C473S probably benign Het
Nefh T C 11: 4,939,656 T988A unknown Het
Nwd2 T A 5: 63,804,460 D462E probably benign Het
Olfr332 T C 11: 58,490,087 T223A probably benign Het
Plec T C 15: 76,181,067 E1466G unknown Het
Prl3d2 G T 13: 27,122,396 M35I probably benign Het
Reln T A 5: 22,152,463 I202F probably benign Het
Rhot1 T A 11: 80,225,602 D78E probably benign Het
Rsph3b T C 17: 6,905,129 probably null Het
Scn10a C T 9: 119,609,651 M1717I probably damaging Het
Sema6a T A 18: 47,249,296 H728L possibly damaging Het
Slc26a3 G T 12: 31,457,080 A345S possibly damaging Het
Slc35d2 A G 13: 64,099,283 V261A possibly damaging Het
Ssmem1 A G 6: 30,519,514 D66G probably damaging Het
Sult2a8 A T 7: 14,425,477 N72K probably benign Het
Tbx10 T C 19: 3,996,921 L108P probably damaging Het
Tex14 T C 11: 87,536,865 S48P probably damaging Het
Tmie A G 9: 110,867,528 L95P probably damaging Het
Tom1l2 C G 11: 60,270,433 R84P probably damaging Het
Trpm3 T A 19: 22,889,435 D543E possibly damaging Het
Vipr2 A C 12: 116,080,131 R49S probably benign Het
Vps8 A T 16: 21,442,439 S110C probably damaging Het
Other mutations in Zfp791
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01512:Zfp791 APN 8 85113543 missense probably damaging 1.00
R0004:Zfp791 UTSW 8 85110866 missense probably benign 0.01
R0085:Zfp791 UTSW 8 85112233 nonsense probably null
R0496:Zfp791 UTSW 8 85109980 missense probably benign 0.03
R1196:Zfp791 UTSW 8 85110954 nonsense probably null
R1927:Zfp791 UTSW 8 85110683 missense probably benign 0.17
R4240:Zfp791 UTSW 8 85109666 missense probably null 1.00
R4370:Zfp791 UTSW 8 85113606 missense probably damaging 1.00
R4637:Zfp791 UTSW 8 85109885 missense possibly damaging 0.93
R4684:Zfp791 UTSW 8 85110930 missense probably benign 0.08
R4822:Zfp791 UTSW 8 85110406 missense probably benign 0.01
R4914:Zfp791 UTSW 8 85110951 missense probably benign 0.06
R4915:Zfp791 UTSW 8 85110951 missense probably benign 0.06
R4916:Zfp791 UTSW 8 85110951 missense probably benign 0.06
R4918:Zfp791 UTSW 8 85110951 missense probably benign 0.06
R5106:Zfp791 UTSW 8 85110630 nonsense probably null
R5549:Zfp791 UTSW 8 85110206 missense probably damaging 1.00
R6093:Zfp791 UTSW 8 85113506 critical splice donor site probably null
R6362:Zfp791 UTSW 8 85119650 start gained probably benign
R7737:Zfp791 UTSW 8 85112215 missense probably benign 0.02
R8986:Zfp791 UTSW 8 85110698 missense probably benign 0.00
R9050:Zfp791 UTSW 8 85110705 missense possibly damaging 0.63
Predicted Primers PCR Primer
(F):5'- GTGGCCCTACATTCCTTACAT -3'
(R):5'- GGCTTTCTCCAGGCCCTG -3'

Sequencing Primer
(F):5'- GCCCTACATTCCTTACATTTAAATCG -3'
(R):5'- CCAGAAGTTATGTGATACAAAG -3'
Posted On 2015-10-21