Incidental Mutation 'R4713:Col5a3'
ID353377
Institutional Source Beutler Lab
Gene Symbol Col5a3
Ensembl Gene ENSMUSG00000004098
Gene Namecollagen, type V, alpha 3
SynonymsPro-alpha3(V)
MMRRC Submission 041601-MU
Accession Numbers

Ncbi RefSeq: NM_016919.2; MGI:1858212

Is this an essential gene? Probably non essential (E-score: 0.249) question?
Stock #R4713 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location20770050-20815067 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 20793574 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 762 (E762G)
Ref Sequence ENSEMBL: ENSMUSP00000004201 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000004201]
Predicted Effect unknown
Transcript: ENSMUST00000004201
AA Change: E762G
SMART Domains Protein: ENSMUSP00000004201
Gene: ENSMUSG00000004098
AA Change: E762G

DomainStartEndE-ValueType
signal peptide 1 29 N/A INTRINSIC
TSPN 32 211 7.08e-28 SMART
LamG 89 210 2.13e-2 SMART
low complexity region 247 267 N/A INTRINSIC
low complexity region 295 314 N/A INTRINSIC
low complexity region 341 347 N/A INTRINSIC
low complexity region 369 381 N/A INTRINSIC
low complexity region 391 434 N/A INTRINSIC
low complexity region 461 474 N/A INTRINSIC
Pfam:Collagen 475 538 5.5e-10 PFAM
low complexity region 597 616 N/A INTRINSIC
low complexity region 628 694 N/A INTRINSIC
internal_repeat_3 703 737 7.13e-16 PROSPERO
low complexity region 742 821 N/A INTRINSIC
low complexity region 823 844 N/A INTRINSIC
low complexity region 859 889 N/A INTRINSIC
internal_repeat_2 892 1081 5.05e-17 PROSPERO
internal_repeat_1 996 1133 7.47e-22 PROSPERO
internal_repeat_3 1105 1139 7.13e-16 PROSPERO
low complexity region 1140 1165 N/A INTRINSIC
low complexity region 1168 1255 N/A INTRINSIC
low complexity region 1258 1282 N/A INTRINSIC
low complexity region 1285 1306 N/A INTRINSIC
low complexity region 1311 1418 N/A INTRINSIC
Pfam:Collagen 1429 1491 9.5e-10 PFAM
COLFI 1508 1738 7.98e-92 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145974
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.7%
  • 20x: 94.0%
Validation Efficiency
MGI Phenotype Strain: 5000519
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an alpha chain for one of the low abundance fibrillar collagens. Fibrillar collagen molecules are trimers that can be composed of one or more types of alpha chains. Type V collagen is found in tissues containing type I collagen and appears to regulate the assembly of heterotypic fibers composed of both type I and type V collagen. This gene product is closely related to type XI collagen and it is possible that the collagen chains of types V and XI constitute a single collagen type with tissue-specific chain combinations. Mutations in this gene are thought to be responsible for the symptoms of a subset of patients with Ehlers-Danlos syndrome type III. Messages of several sizes can be detected in northern blots but sequence information cannot confirm the identity of the shorter messages. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null mutation show decreased pancreatic beta cell mass, hyperglycemia, hypoinsulinemia, impaired glucose tolerance, insulin resistance and impaired glucose uptake. Homozygous females show decreased susceptibility to diet-induced obesity and a thin hypodermal fat layer. [provided by MGI curators]
Allele List at MGI

All alleles(3) : Targeted(3)

Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrb3 G T 1: 25,547,532 T360K probably damaging Het
AW551984 T C 9: 39,597,153 K356E probably benign Het
Bpifb2 T A 2: 153,881,193 V123E probably damaging Het
Cacna1a T G 8: 84,549,514 F532V probably damaging Het
Cct8 C A 16: 87,487,688 E204* probably null Het
Cd163 T A 6: 124,317,618 probably null Het
Cep152 C A 2: 125,587,948 A685S possibly damaging Het
Chdh A G 14: 30,036,841 D581G probably benign Het
Cnpy3 A C 17: 46,747,465 Y77* probably null Het
Creb3 A G 4: 43,563,247 T115A probably benign Het
Dlat G T 9: 50,644,481 A412E probably benign Het
Dnah2 T C 11: 69,476,688 N1789S probably damaging Het
Dzank1 C T 2: 144,491,804 E370K probably benign Het
Eif3m A T 2: 105,006,839 probably null Het
Gimap8 A T 6: 48,658,986 M562L probably benign Het
Gm15448 G T 7: 3,822,681 Y396* probably null Het
Gprc6a T A 10: 51,631,457 probably benign Het
Gsr T G 8: 33,680,319 probably null Het
Gstcd A G 3: 132,983,099 V630A probably damaging Het
Hip1r T C 5: 123,989,980 I116T probably benign Het
Hivep3 A G 4: 120,131,803 E1817G probably damaging Het
Inpp5f A C 7: 128,663,725 T135P probably damaging Het
Ism2 A G 12: 87,285,027 silent Het
Itga11 A G 9: 62,765,788 D784G probably damaging Het
Itpr2 A G 6: 146,373,173 F837S probably damaging Het
Itpr2 T C 6: 146,396,958 E10G probably damaging Het
Knl1 A T 2: 119,069,137 K440* probably null Het
Lonp2 T C 8: 86,713,315 S648P probably damaging Het
Lrba T C 3: 86,359,868 S1622P probably benign Het
Lrp2 G T 2: 69,487,966 A2047D probably damaging Het
Mcm3 G A 1: 20,803,577 T773I probably benign Het
Mfsd7a T C 5: 108,442,079 T486A probably damaging Het
Mki67 A G 7: 135,695,469 V2612A probably benign Het
Mnx1 C A 5: 29,478,131 G49W probably damaging Het
Muc5b T A 7: 141,849,079 Y673* probably null Het
Myo15 A G 11: 60,479,930 H1172R probably benign Het
Myo1g T C 11: 6,516,080 K363R probably null Het
Ncoa4 T A 14: 32,176,641 C473S probably benign Het
Nefh T C 11: 4,939,656 T988A unknown Het
Nwd2 T A 5: 63,804,460 D462E probably benign Het
Olfr332 T C 11: 58,490,087 T223A probably benign Het
Plec T C 15: 76,181,067 E1466G unknown Het
Prl3d2 G T 13: 27,122,396 M35I probably benign Het
Reln T A 5: 22,152,463 I202F probably benign Het
Rhot1 T A 11: 80,225,602 D78E probably benign Het
Rsph3b T C 17: 6,905,129 probably null Het
Scn10a C T 9: 119,609,651 M1717I probably damaging Het
Sema6a T A 18: 47,249,296 H728L possibly damaging Het
Slc26a3 G T 12: 31,457,080 A345S possibly damaging Het
Slc35d2 A G 13: 64,099,283 V261A possibly damaging Het
Ssmem1 A G 6: 30,519,514 D66G probably damaging Het
Sult2a8 A T 7: 14,425,477 N72K probably benign Het
Tbx10 T C 19: 3,996,921 L108P probably damaging Het
Tex14 T C 11: 87,536,865 S48P probably damaging Het
Tmie A G 9: 110,867,528 L95P probably damaging Het
Tom1l2 C G 11: 60,270,433 R84P probably damaging Het
Trpm3 T A 19: 22,889,435 D543E possibly damaging Het
Vipr2 A C 12: 116,080,131 R49S probably benign Het
Vps8 A T 16: 21,442,439 S110C probably damaging Het
Zfp791 T A 8: 85,110,968 N89I probably damaging Het
Other mutations in Col5a3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00834:Col5a3 APN 9 20786389 nonsense probably null
IGL01548:Col5a3 APN 9 20803000 splice site probably benign
IGL02164:Col5a3 APN 9 20792643 critical splice donor site probably null
IGL02297:Col5a3 APN 9 20772154 missense unknown
IGL02333:Col5a3 APN 9 20799306 missense unknown
IGL02349:Col5a3 APN 9 20772361 missense unknown
IGL02390:Col5a3 APN 9 20776996 missense unknown
IGL02685:Col5a3 APN 9 20772205 missense unknown
IGL02941:Col5a3 APN 9 20804666 missense unknown
IGL03001:Col5a3 APN 9 20807744 missense unknown
IGL03061:Col5a3 APN 9 20797572 critical splice donor site probably null
IGL03102:Col5a3 APN 9 20804635 critical splice donor site probably null
IGL03308:Col5a3 APN 9 20808379 missense unknown
IGL03372:Col5a3 APN 9 20775328 missense unknown
R0002:Col5a3 UTSW 9 20809856 critical splice acceptor site probably null
R0012:Col5a3 UTSW 9 20777108 splice site probably benign
R0316:Col5a3 UTSW 9 20775325 missense unknown
R0357:Col5a3 UTSW 9 20807768 splice site probably benign
R0360:Col5a3 UTSW 9 20772466 missense unknown
R0483:Col5a3 UTSW 9 20782481 splice site probably null
R0485:Col5a3 UTSW 9 20782708 missense probably damaging 0.99
R0627:Col5a3 UTSW 9 20775485 missense unknown
R1035:Col5a3 UTSW 9 20793499 splice site probably benign
R1051:Col5a3 UTSW 9 20775235 missense unknown
R1295:Col5a3 UTSW 9 20808418 missense unknown
R1438:Col5a3 UTSW 9 20779957 missense probably damaging 0.99
R1622:Col5a3 UTSW 9 20772220 missense unknown
R1668:Col5a3 UTSW 9 20771096 missense unknown
R1680:Col5a3 UTSW 9 20784668 critical splice donor site probably null
R2112:Col5a3 UTSW 9 20809777 missense unknown
R2149:Col5a3 UTSW 9 20771270 missense unknown
R2159:Col5a3 UTSW 9 20771310 missense unknown
R2939:Col5a3 UTSW 9 20795658 missense unknown
R3236:Col5a3 UTSW 9 20807653 missense unknown
R3845:Col5a3 UTSW 9 20808377 missense unknown
R4598:Col5a3 UTSW 9 20774559 critical splice donor site probably null
R4599:Col5a3 UTSW 9 20774559 critical splice donor site probably null
R4611:Col5a3 UTSW 9 20814896 unclassified probably benign
R4723:Col5a3 UTSW 9 20809591 missense unknown
R5209:Col5a3 UTSW 9 20778643 intron probably benign
R5336:Col5a3 UTSW 9 20799301 missense unknown
R5378:Col5a3 UTSW 9 20797576 missense unknown
R5614:Col5a3 UTSW 9 20783476 splice site probably benign
R5775:Col5a3 UTSW 9 20801072 missense unknown
R5895:Col5a3 UTSW 9 20772442 missense unknown
R6048:Col5a3 UTSW 9 20807619 missense unknown
R6265:Col5a3 UTSW 9 20793764 missense unknown
R6372:Col5a3 UTSW 9 20785586 missense probably damaging 0.99
R6520:Col5a3 UTSW 9 20774052 missense unknown
R6558:Col5a3 UTSW 9 20779033 missense probably damaging 1.00
R6608:Col5a3 UTSW 9 20774019 missense unknown
R6679:Col5a3 UTSW 9 20779033 missense probably damaging 1.00
R6680:Col5a3 UTSW 9 20779033 missense probably damaging 1.00
R6696:Col5a3 UTSW 9 20779033 missense probably damaging 1.00
R6698:Col5a3 UTSW 9 20779033 missense probably damaging 1.00
R6700:Col5a3 UTSW 9 20779033 missense probably damaging 1.00
R6708:Col5a3 UTSW 9 20775035 missense unknown
R6712:Col5a3 UTSW 9 20779033 missense probably damaging 1.00
R6714:Col5a3 UTSW 9 20779033 missense probably damaging 1.00
R6828:Col5a3 UTSW 9 20798452 missense unknown
R7343:Col5a3 UTSW 9 20793946 critical splice donor site probably null
R7431:Col5a3 UTSW 9 20770835 makesense probably null
R7500:Col5a3 UTSW 9 20800289 missense unknown
R7592:Col5a3 UTSW 9 20797393 missense unknown
R7671:Col5a3 UTSW 9 20775086 critical splice acceptor site probably null
Z1177:Col5a3 UTSW 9 20775334 missense unknown
Predicted Primers PCR Primer
(F):5'- ATGAAGTATGCCGGGTTAGCTC -3'
(R):5'- TTCAAGGGTGATGAGGGACC -3'

Sequencing Primer
(F):5'- TGTCCAGAATCCCCCAGTGAG -3'
(R):5'- CCAAAAGGCGACCGGGTAAG -3'
Posted On2015-10-21