Incidental Mutation 'R4713:AW551984'
ID353378
Institutional Source Beutler Lab
Gene Symbol AW551984
Ensembl Gene ENSMUSG00000038112
Gene Nameexpressed sequence AW551984
Synonyms
MMRRC Submission 041601-MU
Accession Numbers

Genbank: NM_178737; MGI: 2143322

Is this an essential gene? Probably non essential (E-score: 0.059) question?
Stock #R4713 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location39587396-39604403 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 39597153 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamic Acid at position 356 (K356E)
Ref Sequence ENSEMBL: ENSMUSP00000113212 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042485] [ENSMUST00000119722] [ENSMUST00000130829] [ENSMUST00000141370]
Predicted Effect probably benign
Transcript: ENSMUST00000042485
AA Change: K356E

PolyPhen 2 Score 0.127 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000042582
Gene: ENSMUSG00000038112
AA Change: K356E

DomainStartEndE-ValueType
VIT 1 131 1.59e-47 SMART
VWA 279 460 1.04e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000119722
AA Change: K356E

PolyPhen 2 Score 0.127 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000113212
Gene: ENSMUSG00000038112
AA Change: K356E

DomainStartEndE-ValueType
VIT 1 131 1.59e-47 SMART
VWA 279 460 1.04e-6 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128054
Predicted Effect probably benign
Transcript: ENSMUST00000130829
SMART Domains Protein: ENSMUSP00000117262
Gene: ENSMUSG00000038112

DomainStartEndE-ValueType
Pfam:VIT_2 5 52 1.4e-10 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136814
Predicted Effect probably benign
Transcript: ENSMUST00000141370
SMART Domains Protein: ENSMUSP00000117328
Gene: ENSMUSG00000038112

DomainStartEndE-ValueType
VIT 1 131 1.59e-47 SMART
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.7%
  • 20x: 94.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrb3 G T 1: 25,547,532 T360K probably damaging Het
Bpifb2 T A 2: 153,881,193 V123E probably damaging Het
Cacna1a T G 8: 84,549,514 F532V probably damaging Het
Cct8 C A 16: 87,487,688 E204* probably null Het
Cd163 T A 6: 124,317,618 probably null Het
Cep152 C A 2: 125,587,948 A685S possibly damaging Het
Chdh A G 14: 30,036,841 D581G probably benign Het
Cnpy3 A C 17: 46,747,465 Y77* probably null Het
Col5a3 T C 9: 20,793,574 E762G unknown Het
Creb3 A G 4: 43,563,247 T115A probably benign Het
Dlat G T 9: 50,644,481 A412E probably benign Het
Dnah2 T C 11: 69,476,688 N1789S probably damaging Het
Dzank1 C T 2: 144,491,804 E370K probably benign Het
Eif3m A T 2: 105,006,839 probably null Het
Gimap8 A T 6: 48,658,986 M562L probably benign Het
Gm15448 G T 7: 3,822,681 Y396* probably null Het
Gprc6a T A 10: 51,631,457 probably benign Het
Gsr T G 8: 33,680,319 probably null Het
Gstcd A G 3: 132,983,099 V630A probably damaging Het
Hip1r T C 5: 123,989,980 I116T probably benign Het
Hivep3 A G 4: 120,131,803 E1817G probably damaging Het
Inpp5f A C 7: 128,663,725 T135P probably damaging Het
Ism2 A G 12: 87,285,027 silent Het
Itga11 A G 9: 62,765,788 D784G probably damaging Het
Itpr2 A G 6: 146,373,173 F837S probably damaging Het
Itpr2 T C 6: 146,396,958 E10G probably damaging Het
Knl1 A T 2: 119,069,137 K440* probably null Het
Lonp2 T C 8: 86,713,315 S648P probably damaging Het
Lrba T C 3: 86,359,868 S1622P probably benign Het
Lrp2 G T 2: 69,487,966 A2047D probably damaging Het
Mcm3 G A 1: 20,803,577 T773I probably benign Het
Mfsd7a T C 5: 108,442,079 T486A probably damaging Het
Mki67 A G 7: 135,695,469 V2612A probably benign Het
Mnx1 C A 5: 29,478,131 G49W probably damaging Het
Muc5b T A 7: 141,849,079 Y673* probably null Het
Myo15 A G 11: 60,479,930 H1172R probably benign Het
Myo1g T C 11: 6,516,080 K363R probably null Het
Ncoa4 T A 14: 32,176,641 C473S probably benign Het
Nefh T C 11: 4,939,656 T988A unknown Het
Nwd2 T A 5: 63,804,460 D462E probably benign Het
Olfr332 T C 11: 58,490,087 T223A probably benign Het
Plec T C 15: 76,181,067 E1466G unknown Het
Prl3d2 G T 13: 27,122,396 M35I probably benign Het
Reln T A 5: 22,152,463 I202F probably benign Het
Rhot1 T A 11: 80,225,602 D78E probably benign Het
Rsph3b T C 17: 6,905,129 probably null Het
Scn10a C T 9: 119,609,651 M1717I probably damaging Het
Sema6a T A 18: 47,249,296 H728L possibly damaging Het
Slc26a3 G T 12: 31,457,080 A345S possibly damaging Het
Slc35d2 A G 13: 64,099,283 V261A possibly damaging Het
Ssmem1 A G 6: 30,519,514 D66G probably damaging Het
Sult2a8 A T 7: 14,425,477 N72K probably benign Het
Tbx10 T C 19: 3,996,921 L108P probably damaging Het
Tex14 T C 11: 87,536,865 S48P probably damaging Het
Tmie A G 9: 110,867,528 L95P probably damaging Het
Tom1l2 C G 11: 60,270,433 R84P probably damaging Het
Trpm3 T A 19: 22,889,435 D543E possibly damaging Het
Vipr2 A C 12: 116,080,131 R49S probably benign Het
Vps8 A T 16: 21,442,439 S110C probably damaging Het
Zfp791 T A 8: 85,110,968 N89I probably damaging Het
Other mutations in AW551984
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00429:AW551984 APN 9 39592849 missense probably benign 0.16
IGL00869:AW551984 APN 9 39593434 splice site probably benign
IGL01411:AW551984 APN 9 39593791 missense possibly damaging 0.69
IGL01744:AW551984 APN 9 39591272 missense probably benign 0.01
IGL02102:AW551984 APN 9 39589691 missense probably damaging 1.00
IGL02149:AW551984 APN 9 39592924 missense probably benign 0.06
IGL02151:AW551984 APN 9 39592945 missense probably benign 0.35
IGL02154:AW551984 APN 9 39589102 missense possibly damaging 0.93
IGL02158:AW551984 APN 9 39599325 missense probably null 0.99
IGL02574:AW551984 APN 9 39589086 missense possibly damaging 0.91
IGL02754:AW551984 APN 9 39596626 nonsense probably null
IGL02754:AW551984 APN 9 39593328 critical splice donor site probably null
IGL02838:AW551984 APN 9 39594643 missense probably damaging 1.00
IGL03240:AW551984 APN 9 39589122 missense probably benign 0.00
IGL03328:AW551984 APN 9 39597116 missense probably damaging 1.00
IGL03374:AW551984 APN 9 39599766 missense possibly damaging 0.52
PIT4260001:AW551984 UTSW 9 39592979 missense probably benign 0.08
R0141:AW551984 UTSW 9 39590644 missense probably damaging 1.00
R0269:AW551984 UTSW 9 39599950 missense probably damaging 1.00
R0365:AW551984 UTSW 9 39599321 missense probably benign 0.14
R0453:AW551984 UTSW 9 39600641 missense probably damaging 1.00
R0481:AW551984 UTSW 9 39600616 missense probably null 1.00
R1005:AW551984 UTSW 9 39593733 nonsense probably null
R1585:AW551984 UTSW 9 39599336 nonsense probably null
R2177:AW551984 UTSW 9 39599815 missense probably benign
R3117:AW551984 UTSW 9 39593360 missense probably benign 0.08
R3119:AW551984 UTSW 9 39593360 missense probably benign 0.08
R3162:AW551984 UTSW 9 39593029 missense probably damaging 1.00
R3162:AW551984 UTSW 9 39593029 missense probably damaging 1.00
R3836:AW551984 UTSW 9 39597908 unclassified probably benign
R3837:AW551984 UTSW 9 39597908 unclassified probably benign
R3839:AW551984 UTSW 9 39597908 unclassified probably benign
R4299:AW551984 UTSW 9 39592979 missense probably benign 0.08
R4422:AW551984 UTSW 9 39600077 missense probably null 0.00
R4905:AW551984 UTSW 9 39597158 missense probably damaging 0.99
R4966:AW551984 UTSW 9 39597176 missense possibly damaging 0.92
R5022:AW551984 UTSW 9 39597965 missense probably benign 0.00
R5041:AW551984 UTSW 9 39600598 missense probably damaging 1.00
R5342:AW551984 UTSW 9 39594551 missense probably damaging 1.00
R5383:AW551984 UTSW 9 39590698 missense probably benign
R5443:AW551984 UTSW 9 39598029 missense possibly damaging 0.94
R5532:AW551984 UTSW 9 39597185 missense probably damaging 1.00
R5536:AW551984 UTSW 9 39592873 missense probably benign 0.04
R5586:AW551984 UTSW 9 39591263 missense probably benign 0.01
R5601:AW551984 UTSW 9 39591267 missense possibly damaging 0.87
R5618:AW551984 UTSW 9 39590704 missense probably damaging 1.00
R5701:AW551984 UTSW 9 39592822 missense probably benign 0.01
R6122:AW551984 UTSW 9 39593755 missense probably benign 0.00
R6142:AW551984 UTSW 9 39597114 missense probably benign 0.00
R6272:AW551984 UTSW 9 39598037 missense probably benign 0.06
R6429:AW551984 UTSW 9 39600614 missense probably damaging 1.00
R6659:AW551984 UTSW 9 39589099 missense probably benign 0.00
R6670:AW551984 UTSW 9 39592996 missense probably damaging 1.00
R6791:AW551984 UTSW 9 39600659 missense probably damaging 1.00
R7000:AW551984 UTSW 9 39600789 missense probably benign 0.11
R7077:AW551984 UTSW 9 39591427 missense probably benign
R7083:AW551984 UTSW 9 39597647 missense probably damaging 1.00
R7352:AW551984 UTSW 9 39592925 missense probably benign
R7475:AW551984 UTSW 9 39597940 missense probably damaging 1.00
R7534:AW551984 UTSW 9 39591481 missense probably benign 0.03
R7542:AW551984 UTSW 9 39594631 missense possibly damaging 0.95
R7708:AW551984 UTSW 9 39593755 missense probably benign 0.00
R7729:AW551984 UTSW 9 39599775 missense possibly damaging 0.89
R7955:AW551984 UTSW 9 39596664 missense probably damaging 1.00
R8122:AW551984 UTSW 9 39599369 missense probably damaging 1.00
R8358:AW551984 UTSW 9 39599355 missense probably damaging 0.99
R8402:AW551984 UTSW 9 39597653 missense probably damaging 1.00
R8683:AW551984 UTSW 9 39599709 missense possibly damaging 0.86
R8810:AW551984 UTSW 9 39600011 missense probably damaging 1.00
R8857:AW551984 UTSW 9 39600535 missense probably damaging 1.00
R8871:AW551984 UTSW 9 39589702 nonsense probably null
Z1088:AW551984 UTSW 9 39590603 nonsense probably null
ZE80:AW551984 UTSW 9 39593667 splice site probably null
Predicted Primers PCR Primer
(F):5'- CTCCTATATAGCAGAAGCCTGG -3'
(R):5'- GGGTAGGTGTAAAGCTGACC -3'

Sequencing Primer
(F):5'- AGCCTGGAGTACATACAGTGTTTCC -3'
(R):5'- TGTAAAGCTGACCTGAACTTGG -3'
Posted On2015-10-21