Mutagenetix > Incidental Mutation

Incidental Mutation 'R0276:Aspm'

35338

Institutional Source

Beutler Lab

Gene Symbol

Aspm

Ensembl Gene

ENSMUSG00000033952

Gene Name

abnormal spindle microtubule assembly

Synonyms

Aspm, Sha1, MCPH5, D330028K02Rik, Calmbp1

MMRRC Submission

038498-MU

Accession Numbers

Genbank: NM_009791; MGI: 1334448

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R0276 (G1)

Quality Score

Status

Not validated

Chromosome

Chromosomal Location

139454772-139494091 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 139478471 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Proline at position 1699 (S1699P)

Ref Sequence

ENSEMBL: ENSMUSP00000059159 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000053364] [ENSMUST00000200083]

AlphaFold

no structure available at present

Predicted Effect

possibly damaging
Transcript: ENSMUST00000053364
AA Change: S1699P

PolyPhen 2 Score 0.947 (Sensitivity: 0.79; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000059159
Gene: ENSMUSG00000033952
AA Change: S1699P

Domain	Start	End	E-Value	Type
Pfam:ASH	29	126	8.9e-35	PFAM
low complexity region	855	861	N/A	INTRINSIC
CH	890	1022	2.04e0	SMART
CH	1080	1224	5.56e-9	SMART
IQ	1233	1255	7.57e0	SMART
IQ	1259	1281	1.12e1	SMART
IQ	1282	1304	3.73e-1	SMART
IQ	1314	1336	2.41e-4	SMART
IQ	1360	1382	2.12e1	SMART
IQ	1387	1408	7.61e1	SMART
IQ	1409	1431	6.97e0	SMART
IQ	1432	1452	1.44e1	SMART
IQ	1453	1475	1.15e-1	SMART
IQ	1476	1495	1.66e2	SMART
IQ	1503	1525	1.65e-2	SMART
IQ	1526	1548	1.32e1	SMART
IQ	1549	1571	1.48e1	SMART
IQ	1572	1594	2.5e1	SMART
IQ	1599	1621	2.58e-4	SMART
IQ	1622	1644	6.7e-3	SMART
IQ	1645	1667	4.25e1	SMART
IQ	1668	1694	1.03e2	SMART
IQ	1695	1717	2.33e-2	SMART
IQ	1718	1740	7.79e0	SMART
IQ	1741	1763	1.57e2	SMART
IQ	1768	1790	2.68e-2	SMART
IQ	1791	1813	5.83e-3	SMART
IQ	1814	1836	5.93e1	SMART
IQ	1841	1863	1.92e-3	SMART
IQ	1864	1886	3.79e-2	SMART
IQ	1914	1936	4.11e0	SMART
IQ	1937	1959	1.87e-1	SMART
IQ	1960	1982	6.27e1	SMART
IQ	1987	2009	8.25e-3	SMART
IQ	2010	2032	5.73e0	SMART
IQ	2060	2082	1.39e0	SMART
IQ	2083	2105	4.62e1	SMART
IQ	2133	2155	5.58e0	SMART
IQ	2156	2178	7.07e-2	SMART
IQ	2206	2228	1.18e-3	SMART
IQ	2229	2251	4.59e0	SMART
IQ	2278	2300	1.85e-5	SMART
IQ	2301	2323	8.13e-2	SMART
IQ	2342	2364	9.62e-4	SMART
IQ	2365	2387	4.12e-3	SMART
IQ	2415	2437	7.58e-2	SMART
IQ	2438	2460	2.6e0	SMART
IQ	2490	2512	1.68e-3	SMART
IQ	2513	2535	8.51e1	SMART
IQ	2560	2582	2.14e-1	SMART
IQ	2601	2623	8.46e0	SMART
IQ	2647	2669	1.15e1	SMART
IQ	2673	2695	1.95e-4	SMART
IQ	2696	2718	4.13e1	SMART
IQ	2723	2745	1.02e-2	SMART
IQ	2761	2783	3.14e2	SMART
IQ	2784	2806	1e1	SMART
IQ	2825	2847	2.43e0	SMART
IQ	2848	2870	4.6e-1	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000199998

Predicted Effect

probably benign
Transcript: ENSMUST00000200083

SMART Domains

Protein: ENSMUSP00000142880
Gene: ENSMUSG00000033952

Domain	Start	End	E-Value	Type
low complexity region	855	861	N/A	INTRINSIC
CH	890	1022	2.04e0	SMART
CH	1080	1224	5.56e-9	SMART
IQ	1233	1255	7.57e0	SMART
IQ	1259	1281	1.12e1	SMART
IQ	1282	1304	3.73e-1	SMART
IQ	1314	1336	1.25e1	SMART
IQ	1337	1358	2.96e1	SMART
IQ	1382	1404	1.15e1	SMART
IQ	1408	1430	1.95e-4	SMART
IQ	1431	1453	4.13e1	SMART
IQ	1458	1480	1.02e-2	SMART
IQ	1496	1518	3.14e2	SMART
IQ	1519	1541	1e1	SMART
IQ	1560	1582	2.43e0	SMART
IQ	1583	1605	4.6e-1	SMART

Coding Region Coverage

1x: 98.7%
3x: 97.8%
10x: 96.2%
20x: 93.8%

Validation Efficiency

98% (101/103)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is the human ortholog of the Drosophila melanogaster 'abnormal spindle' gene (asp), which is essential for normal mitotic spindle function in embryonic neuroblasts. Studies in mouse also suggest a role of this gene in mitotic spindle regulation, with a preferential role in regulating neurogenesis. Mutations in this gene are associated with microcephaly primary type 5. Multiple transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, May 2011]
PHENOTYPE: Mice homozygous for protein-truncating gene trap mutations of this gene exhibit decreased body weight, microcephaly, a severe reduction in brain, testis and ovary weight, oligozoospermia and asthenospermia, and reduced fertility in both sexes. [provided by MGI curators]

Allele List at MGI

All alleles(9) : Targeted, other(2) Gene trapped(7)

Other mutations in this stock

Total: 100 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adamts13	A	G	2: 26,975,760	N109S	possibly damaging	Het
Adcy10	T	A	1: 165,572,591	M1523K	possibly damaging	Het
Agtpbp1	C	T	13: 59,462,031	S1095N	possibly damaging	Het
Ang2	C	T	14: 51,195,518	V136I	probably damaging	Het
Arhgap10	A	T	8: 77,413,581	M250K	probably benign	Het
Arhgap33	A	T	7: 30,523,244	W1088R	probably benign	Het
Arhgef15	T	C	11: 68,953,472		probably benign	Het
Atp12a	C	A	14: 56,387,694	D1014E	probably damaging	Het
Atp1a4	T	A	1: 172,257,901	K45M	probably damaging	Het
Atp8a1	A	T	5: 67,786,673		probably benign	Het
Baiap3	A	C	17: 25,243,687	F1099C	probably damaging	Het
Bcas3	T	A	11: 85,470,837		probably null	Het
Bms1	G	A	6: 118,408,134	T371M	possibly damaging	Het
Camta1	C	A	4: 151,075,140	R1614L	probably damaging	Het
Capn3	T	C	2: 120,488,065		probably benign	Het
Ccdc180	A	G	4: 45,923,534	D1105G	probably damaging	Het
Ccdc33	G	T	9: 58,058,392	P364Q	probably damaging	Het
Ccdc36	A	T	9: 108,428,440	M11K	possibly damaging	Het
Clstn3	A	G	6: 124,431,740		probably benign	Het
Cntrl	A	T	2: 35,151,732	Y619F	possibly damaging	Het
Col12a1	A	T	9: 79,630,741	Y2514*	probably null	Het
Cpt1b	T	C	15: 89,419,959	H503R	probably benign	Het
Crb1	T	A	1: 139,323,335	T293S	possibly damaging	Het
D130043K22Rik	C	T	13: 24,858,045	T319I	possibly damaging	Het
Dzip1l	G	A	9: 99,660,998	R502Q	probably benign	Het
Efcab5	A	G	11: 77,129,876	M673T	probably damaging	Het
Efcab5	G	A	11: 77,140,923	R42W	probably damaging	Het
F2rl3	A	G	8: 72,762,798	T218A	probably benign	Het
Fam135a	C	T	1: 24,067,964	R31H	probably damaging	Het
Fam84b	G	T	15: 60,823,674	Y74*	probably null	Het
Fcer2a	A	T	8: 3,689,811	N53K	possibly damaging	Het
Gm14085	T	A	2: 122,521,928	S389T	probably damaging	Het
Golgb1	A	C	16: 36,913,876	K1162Q	probably damaging	Het
Gpr137b	A	T	13: 13,367,575		probably benign	Het
Haspin	A	T	11: 73,136,487	L592Q	probably damaging	Het
Helq	A	G	5: 100,790,147	F478L	probably damaging	Het
Il17rb	T	A	14: 30,004,380	T84S	probably damaging	Het
Itga4	T	C	2: 79,321,493	L880P	probably damaging	Het
Itih5	A	G	2: 10,185,564	I61V	possibly damaging	Het
Ivl	G	A	3: 92,571,514	L415F	unknown	Het
Kif2a	A	G	13: 106,976,650		probably benign	Het
Kmt2d	T	C	15: 98,850,311		probably benign	Het
Lars2	A	G	9: 123,438,121		probably benign	Het
Lilrb4a	T	C	10: 51,491,581	V73A	probably benign	Het
Lrrc8a	A	G	2: 30,256,788	D538G	possibly damaging	Het
Lrrk1	G	A	7: 66,296,263		probably benign	Het
Mc2r	A	T	18: 68,408,132	I30K	possibly damaging	Het
Mybbp1a	C	A	11: 72,450,107		probably null	Het
Napg	C	T	18: 62,986,963	R149C	probably damaging	Het
Ncam2	A	G	16: 81,517,629		probably benign	Het
Nlk	T	C	11: 78,571,475	I509V	probably benign	Het
Nlrp2	A	T	7: 5,328,109	N429K	probably benign	Het
Nlrp9b	A	G	7: 20,028,498	T247A	probably benign	Het
Noxo1	A	T	17: 24,700,162		probably null	Het
Olfr1212	T	A	2: 88,958,755	C96*	probably null	Het
Olfr139	A	G	11: 74,045,118	I52T	probably damaging	Het
Olfr353	A	T	2: 36,890,023	M275K	probably benign	Het
Olfr701	A	T	7: 106,818,697	I205L	probably benign	Het
Olfr734	C	A	14: 50,320,179	A219S	probably benign	Het
Oxr1	T	C	15: 41,820,062	S294P	probably damaging	Het
Pfpl	A	G	19: 12,429,237	Y284C	probably damaging	Het
Pi16	A	T	17: 29,326,943	T232S	probably benign	Het
Plcxd2	A	T	16: 46,009,707	N50K	probably benign	Het
Plekhn1	T	A	4: 156,228,246	N52Y	probably damaging	Het
Prl2c5	T	C	13: 13,183,049		probably benign	Het
Prrc2b	G	A	2: 32,219,654	V1080I	probably damaging	Het
Psg28	A	T	7: 18,430,396	N130K	probably benign	Het
Psme4	C	A	11: 30,811,980	T440K	probably damaging	Het
Ptcd2	T	C	13: 99,321,596	K296E	probably benign	Het
Ptprq	T	C	10: 107,542,735		probably null	Het
Rab5b	A	C	10: 128,686,746		probably null	Het
Rft1	T	A	14: 30,690,583	S534T	probably benign	Het
Rif1	GCCACCA	GCCA	2: 52,110,324		probably benign	Het
Rsu1	A	T	2: 13,170,135		probably benign	Het
Senp6	A	G	9: 80,136,747	M887V	probably benign	Het
Sgcz	T	A	8: 37,952,919	M60L	probably benign	Het
Siglec1	G	A	2: 131,083,941	Q282*	probably null	Het
Sipa1l2	T	C	8: 125,421,940	T1655A	probably damaging	Het
Slc43a3	G	A	2: 84,937,663		probably benign	Het
Snx29	T	C	16: 11,738,373	V756A	probably benign	Het
Spta1	T	A	1: 174,217,894	H1539Q	probably damaging	Het
Stk3	A	C	15: 35,099,469	S104A	probably damaging	Het
Stk38	C	A	17: 28,992,416		probably null	Het
Stx6	T	C	1: 155,174,163		probably benign	Het
Thbs4	G	A	13: 92,775,532	T230I	probably benign	Het
Thrsp	A	G	7: 97,417,502	M1T	probably null	Het
Tmem63b	A	T	17: 45,675,373		probably benign	Het
Top2a	A	G	11: 99,009,907		probably benign	Het
Tpd52l2	T	C	2: 181,502,059		probably null	Het
Trak1	A	G	9: 121,454,338	E390G	probably damaging	Het
Trappc3	T	A	4: 126,273,952	D101E	possibly damaging	Het
Trhr	A	G	15: 44,197,086	M1V	probably null	Het
Triobp	T	A	15: 78,973,676	I1159K	probably benign	Het
Unc45a	A	G	7: 80,326,297		probably benign	Het
Usb1	A	G	8: 95,333,457	D12G	probably damaging	Het
Ushbp1	C	T	8: 71,394,649	C113Y	possibly damaging	Het
Vim	A	G	2: 13,574,859	K143R	probably benign	Het
Vmn2r75	T	C	7: 86,148,307	K766R	probably benign	Het
Wdr92	T	C	11: 17,229,821	I274T	probably benign	Het
Xpo5	T	G	17: 46,241,507	C1089G	probably damaging	Het

Other mutations in Aspm

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00489:Aspm	APN	1	139478691	missense	probably damaging	1.00
IGL00594:Aspm	APN	1	139487422	splice site	probably benign
IGL00808:Aspm	APN	1	139461476	missense	probably benign	0.03
IGL00897:Aspm	APN	1	139477407	missense	probably damaging	0.98
IGL01024:Aspm	APN	1	139478124	missense	possibly damaging	0.66
IGL01410:Aspm	APN	1	139482444	missense	probably benign	0.25
IGL01588:Aspm	APN	1	139478162	missense	probably benign	0.11
IGL01610:Aspm	APN	1	139489670	nonsense	probably null
IGL01633:Aspm	APN	1	139480836	missense	possibly damaging	0.93
IGL01982:Aspm	APN	1	139491588	missense	probably benign	0.12
IGL02429:Aspm	APN	1	139479810	missense	probably benign	0.27
IGL02468:Aspm	APN	1	139480950	missense	probably damaging	1.00
IGL02519:Aspm	APN	1	139461927	splice site	probably benign
IGL02526:Aspm	APN	1	139489719	missense	probably benign	0.03
IGL02716:Aspm	APN	1	139479687	missense	probably damaging	1.00
IGL02876:Aspm	APN	1	139473653	missense	probably damaging	1.00
IGL02953:Aspm	APN	1	139457419	missense	probably benign	0.01
IGL03275:Aspm	APN	1	139487295	missense	probably damaging	1.00
Stemware	UTSW	1	139477459	nonsense	probably null
3-1:Aspm	UTSW	1	139457541	missense	probably benign
R0016:Aspm	UTSW	1	139479544	missense	probably benign	0.01
R0016:Aspm	UTSW	1	139479544	missense	probably benign	0.01
R0106:Aspm	UTSW	1	139476876	missense	probably benign	0.02
R0106:Aspm	UTSW	1	139476876	missense	probably benign	0.02
R0140:Aspm	UTSW	1	139480641	missense	probably benign	0.00
R0195:Aspm	UTSW	1	139479135	missense	probably damaging	1.00
R0217:Aspm	UTSW	1	139457880	missense	possibly damaging	0.46
R0309:Aspm	UTSW	1	139482511	splice site	probably benign
R0466:Aspm	UTSW	1	139477901	missense	probably damaging	1.00
R0520:Aspm	UTSW	1	139478820	missense	possibly damaging	0.51
R0615:Aspm	UTSW	1	139487289	missense	probably damaging	1.00
R0626:Aspm	UTSW	1	139491601	missense	probably damaging	1.00
R0660:Aspm	UTSW	1	139457764	missense	probably benign	0.03
R0751:Aspm	UTSW	1	139456898	splice site	probably benign
R0830:Aspm	UTSW	1	139474254	missense	probably damaging	0.99
R1109:Aspm	UTSW	1	139456758	missense	probably damaging	0.99
R1114:Aspm	UTSW	1	139461924	splice site	probably benign
R1130:Aspm	UTSW	1	139477834	missense	possibly damaging	0.90
R1298:Aspm	UTSW	1	139457419	missense	probably benign	0.01
R1386:Aspm	UTSW	1	139457623	missense	probably benign	0.03
R1386:Aspm	UTSW	1	139478972	missense	possibly damaging	0.80
R1557:Aspm	UTSW	1	139468668	missense	probably benign	0.01
R1625:Aspm	UTSW	1	139481039	missense	probably benign	0.01
R1728:Aspm	UTSW	1	139473574	missense	probably benign
R1729:Aspm	UTSW	1	139473574	missense	probably benign
R1730:Aspm	UTSW	1	139473574	missense	probably benign
R1733:Aspm	UTSW	1	139457117	missense	probably benign	0.27
R1739:Aspm	UTSW	1	139473574	missense	probably benign
R1762:Aspm	UTSW	1	139473574	missense	probably benign
R1783:Aspm	UTSW	1	139473574	missense	probably benign
R1784:Aspm	UTSW	1	139473574	missense	probably benign
R1785:Aspm	UTSW	1	139473574	missense	probably benign
R1793:Aspm	UTSW	1	139457341	missense	probably benign	0.00
R1893:Aspm	UTSW	1	139479867	missense	probably damaging	1.00
R1911:Aspm	UTSW	1	139478094	missense	probably benign	0.06
R2103:Aspm	UTSW	1	139491665	missense	probably damaging	0.99
R2128:Aspm	UTSW	1	139457635	missense	probably benign	0.14
R2129:Aspm	UTSW	1	139457635	missense	probably benign	0.14
R2239:Aspm	UTSW	1	139456846	missense	possibly damaging	0.67
R2352:Aspm	UTSW	1	139457562	missense	probably benign	0.02
R2353:Aspm	UTSW	1	139477697	missense	probably damaging	1.00
R2380:Aspm	UTSW	1	139479348	missense	probably damaging	1.00
R2413:Aspm	UTSW	1	139477757	missense	probably damaging	1.00
R2421:Aspm	UTSW	1	139488487	missense	possibly damaging	0.49
R3607:Aspm	UTSW	1	139480668	missense	probably benign	0.13
R3711:Aspm	UTSW	1	139458100	missense	probably benign	0.17
R3718:Aspm	UTSW	1	139480889	missense	probably benign	0.09
R3718:Aspm	UTSW	1	139490427	missense	probably benign	0.31
R3741:Aspm	UTSW	1	139478619	missense	possibly damaging	0.47
R3788:Aspm	UTSW	1	139463203	missense	probably damaging	1.00
R3838:Aspm	UTSW	1	139478054	missense	probably benign	0.24
R3839:Aspm	UTSW	1	139478054	missense	probably benign	0.24
R3849:Aspm	UTSW	1	139458286	missense	probably benign	0.21
R4075:Aspm	UTSW	1	139474285	missense	probably damaging	1.00
R4080:Aspm	UTSW	1	139470755	missense	probably damaging	1.00
R4463:Aspm	UTSW	1	139455010	missense	possibly damaging	0.95
R4537:Aspm	UTSW	1	139474303	missense	probably benign	0.01
R4547:Aspm	UTSW	1	139478187	missense	possibly damaging	0.75
R4573:Aspm	UTSW	1	139479507	missense	probably damaging	0.98
R4680:Aspm	UTSW	1	139480671	missense	probably benign	0.05
R4807:Aspm	UTSW	1	139477919	missense	probably damaging	1.00
R4840:Aspm	UTSW	1	139470531	missense	possibly damaging	0.83
R4854:Aspm	UTSW	1	139478072	nonsense	probably null
R4859:Aspm	UTSW	1	139469393	missense	probably damaging	1.00
R4893:Aspm	UTSW	1	139489839	critical splice donor site	probably null
R4910:Aspm	UTSW	1	139491543	missense	probably damaging	1.00
R4953:Aspm	UTSW	1	139471734	missense	probably benign	0.00
R4974:Aspm	UTSW	1	139478010	missense	probably benign	0.03
R4981:Aspm	UTSW	1	139470760	splice site	probably null
R5082:Aspm	UTSW	1	139478676	nonsense	probably null
R5223:Aspm	UTSW	1	139478334	missense	probably damaging	1.00
R5268:Aspm	UTSW	1	139464295	missense	probably damaging	1.00
R5371:Aspm	UTSW	1	139470541	nonsense	probably null
R5377:Aspm	UTSW	1	139457483	missense	probably damaging	0.96
R5377:Aspm	UTSW	1	139470395	splice site	probably null
R5481:Aspm	UTSW	1	139457061	missense	possibly damaging	0.85
R5513:Aspm	UTSW	1	139482398	missense	probably damaging	1.00
R5578:Aspm	UTSW	1	139470717	missense	probably damaging	1.00
R5649:Aspm	UTSW	1	139479669	missense	probably benign
R5685:Aspm	UTSW	1	139487288	missense	probably benign	0.10
R5695:Aspm	UTSW	1	139479669	missense	probably benign
R5766:Aspm	UTSW	1	139479002	missense	probably damaging	0.99
R5964:Aspm	UTSW	1	139455227	intron	probably benign
R5993:Aspm	UTSW	1	139479531	missense	probably benign	0.28
R6027:Aspm	UTSW	1	139463056	missense	probably damaging	1.00
R6029:Aspm	UTSW	1	139480990	missense	possibly damaging	0.83
R6102:Aspm	UTSW	1	139477459	nonsense	probably null
R6188:Aspm	UTSW	1	139479239	missense	possibly damaging	0.79
R6257:Aspm	UTSW	1	139482053	splice site	probably null
R6433:Aspm	UTSW	1	139473683	missense	probably damaging	1.00
R6682:Aspm	UTSW	1	139457722	missense	possibly damaging	0.67
R6763:Aspm	UTSW	1	139470517	missense	possibly damaging	0.64
R6798:Aspm	UTSW	1	139468685	missense	possibly damaging	0.66
R6815:Aspm	UTSW	1	139480142	missense	probably benign	0.04
R6854:Aspm	UTSW	1	139463182	missense	possibly damaging	0.90
R6928:Aspm	UTSW	1	139480206	nonsense	probably null
R6943:Aspm	UTSW	1	139480542	missense	probably damaging	1.00
R6979:Aspm	UTSW	1	139480485	missense	probably damaging	1.00
R6998:Aspm	UTSW	1	139469472	missense	probably damaging	1.00
R7126:Aspm	UTSW	1	139480803	missense	probably benign	0.27
R7237:Aspm	UTSW	1	139477929	missense	possibly damaging	0.81
R7240:Aspm	UTSW	1	139478651	nonsense	probably null
R7272:Aspm	UTSW	1	139458328	missense	probably benign	0.14
R7427:Aspm	UTSW	1	139457616	missense	probably benign	0.01
R7519:Aspm	UTSW	1	139490336	missense	possibly damaging	0.53
R7776:Aspm	UTSW	1	139479846	missense	possibly damaging	0.85
R7875:Aspm	UTSW	1	139455134	missense	probably benign	0.02
R7883:Aspm	UTSW	1	139478667	missense	possibly damaging	0.47
R7964:Aspm	UTSW	1	139480686	missense	probably damaging	1.00
R8012:Aspm	UTSW	1	139457464	missense	probably benign	0.03
R8029:Aspm	UTSW	1	139471632	missense	probably benign	0.00
R8233:Aspm	UTSW	1	139457304	missense	probably benign	0.28
R8277:Aspm	UTSW	1	139455010	missense	probably damaging	1.00
R8345:Aspm	UTSW	1	139464273	nonsense	probably null
R8491:Aspm	UTSW	1	139457695	missense	probably damaging	0.98
R8511:Aspm	UTSW	1	139457308	missense	probably damaging	1.00
R8557:Aspm	UTSW	1	139456756	missense	probably benign	0.01
R8927:Aspm	UTSW	1	139490387	nonsense	probably null
R8928:Aspm	UTSW	1	139490387	nonsense	probably null
R8950:Aspm	UTSW	1	139478952	missense	probably damaging	1.00
R9033:Aspm	UTSW	1	139478127	missense	probably damaging	1.00
R9083:Aspm	UTSW	1	139493698	missense	possibly damaging	0.70
R9133:Aspm	UTSW	1	139491528	missense	probably damaging	1.00
R9160:Aspm	UTSW	1	139490124	missense	probably damaging	1.00
R9179:Aspm	UTSW	1	139476715	missense	probably damaging	1.00
R9265:Aspm	UTSW	1	139461444	missense	probably benign	0.24
R9400:Aspm	UTSW	1	139479903	missense	probably damaging	1.00
R9419:Aspm	UTSW	1	139457185	missense	probably benign	0.29
R9454:Aspm	UTSW	1	139480994	missense	probably benign	0.00
R9517:Aspm	UTSW	1	139479429	missense	probably damaging	1.00
R9524:Aspm	UTSW	1	139480869	missense	probably damaging	1.00
R9544:Aspm	UTSW	1	139457785	missense	probably benign	0.01
R9640:Aspm	UTSW	1	139480272	missense	possibly damaging	0.88
R9698:Aspm	UTSW	1	139461908	missense	probably benign	0.28
R9790:Aspm	UTSW	1	139480637	missense	probably damaging	0.98
R9791:Aspm	UTSW	1	139480637	missense	probably damaging	0.98
R9794:Aspm	UTSW	1	139478742	missense	probably damaging	0.99
X0063:Aspm	UTSW	1	139458090	missense	probably benign	0.01

Predicted Primers

PCR Primer
(F):5'- AAGCATTTCGCCATGCTTTAGCATC -3'
(R):5'- CTGCCTGCAAACAAATAGCTGCTC -3'

Sequencing Primer
(F):5'- AAAGATTCAGTCATATTATCGGGC -3'
(R):5'- GCAAGAAGTTCTTCCTTTGACTG -3'

Posted On

2013-05-09