Incidental Mutation 'R4713:Itga11'
ID 353380
Institutional Source Beutler Lab
Gene Symbol Itga11
Ensembl Gene ENSMUSG00000032243
Gene Name integrin alpha 11
Synonyms 4732459H24Rik
MMRRC Submission 041601-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.163) question?
Stock # R4713 (G1)
Quality Score 225
Status Not validated
Chromosome 9
Chromosomal Location 62585108-62691264 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 62673070 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 784 (D784G)
Ref Sequence ENSEMBL: ENSMUSP00000034774 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034774]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000034774
AA Change: D784G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000034774
Gene: ENSMUSG00000032243
AA Change: D784G

DomainStartEndE-ValueType
Int_alpha 37 90 3.9e-7 SMART
VWA 162 350 2.74e-38 SMART
Int_alpha 421 472 2.19e-1 SMART
Int_alpha 476 532 3.75e-9 SMART
Int_alpha 538 593 1.39e-12 SMART
Int_alpha 600 654 1.08e0 SMART
transmembrane domain 1142 1164 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159012
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.7%
  • 20x: 94.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an alpha integrin. Integrins are heterodimeric integral membrane proteins composed of an alpha chain and a beta chain. This protein contains an I domain, is expressed in muscle tissue, dimerizes with beta 1 integrin in vitro, and appears to bind collagen in this form. Therefore, the protein may be involved in attaching muscle tissue to the extracellular matrix. Alternative transcriptional splice variants have been found for this gene, but their biological validity is not determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a disruption of this gene display dwarfism, increased mortality with age, and defective incisors. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrb3 G T 1: 25,586,613 (GRCm39) T360K probably damaging Het
AW551984 T C 9: 39,508,449 (GRCm39) K356E probably benign Het
Bpifb2 T A 2: 153,723,113 (GRCm39) V123E probably damaging Het
Cacna1a T G 8: 85,276,143 (GRCm39) F532V probably damaging Het
Cct8 C A 16: 87,284,576 (GRCm39) E204* probably null Het
Cd163 T A 6: 124,294,577 (GRCm39) probably null Het
Cep152 C A 2: 125,429,868 (GRCm39) A685S possibly damaging Het
Chdh A G 14: 29,758,798 (GRCm39) D581G probably benign Het
Cnpy3 A C 17: 47,058,391 (GRCm39) Y77* probably null Het
Col5a3 T C 9: 20,704,870 (GRCm39) E762G unknown Het
Creb3 A G 4: 43,563,247 (GRCm39) T115A probably benign Het
Dlat G T 9: 50,555,781 (GRCm39) A412E probably benign Het
Dnah2 T C 11: 69,367,514 (GRCm39) N1789S probably damaging Het
Dzank1 C T 2: 144,333,724 (GRCm39) E370K probably benign Het
Eif3m A T 2: 104,837,184 (GRCm39) probably null Het
Gimap8 A T 6: 48,635,920 (GRCm39) M562L probably benign Het
Gprc6a T A 10: 51,507,553 (GRCm39) probably benign Het
Gsr T G 8: 34,170,347 (GRCm39) probably null Het
Gstcd A G 3: 132,688,860 (GRCm39) V630A probably damaging Het
Hip1r T C 5: 124,128,043 (GRCm39) I116T probably benign Het
Hivep3 A G 4: 119,989,000 (GRCm39) E1817G probably damaging Het
Inpp5f A C 7: 128,265,449 (GRCm39) T135P probably damaging Het
Ism2 A G 12: 87,331,801 (GRCm39) silent Het
Itpr2 A G 6: 146,274,671 (GRCm39) F837S probably damaging Het
Itpr2 T C 6: 146,298,456 (GRCm39) E10G probably damaging Het
Knl1 A T 2: 118,899,618 (GRCm39) K440* probably null Het
Lonp2 T C 8: 87,439,943 (GRCm39) S648P probably damaging Het
Lrba T C 3: 86,267,175 (GRCm39) S1622P probably benign Het
Lrp2 G T 2: 69,318,310 (GRCm39) A2047D probably damaging Het
Mcm3 G A 1: 20,873,801 (GRCm39) T773I probably benign Het
Mki67 A G 7: 135,297,198 (GRCm39) V2612A probably benign Het
Mnx1 C A 5: 29,683,129 (GRCm39) G49W probably damaging Het
Muc5b T A 7: 141,402,816 (GRCm39) Y673* probably null Het
Myo15a A G 11: 60,370,756 (GRCm39) H1172R probably benign Het
Myo1g T C 11: 6,466,080 (GRCm39) K363R probably null Het
Ncoa4 T A 14: 31,898,598 (GRCm39) C473S probably benign Het
Nefh T C 11: 4,889,656 (GRCm39) T988A unknown Het
Nwd2 T A 5: 63,961,803 (GRCm39) D462E probably benign Het
Or2av9 T C 11: 58,380,913 (GRCm39) T223A probably benign Het
Pira13 G T 7: 3,825,680 (GRCm39) Y396* probably null Het
Plec T C 15: 76,065,267 (GRCm39) E1466G unknown Het
Prl3d2 G T 13: 27,306,379 (GRCm39) M35I probably benign Het
Reln T A 5: 22,357,461 (GRCm39) I202F probably benign Het
Rhot1 T A 11: 80,116,428 (GRCm39) D78E probably benign Het
Rsph3b T C 17: 7,172,528 (GRCm39) probably null Het
Scn10a C T 9: 119,438,717 (GRCm39) M1717I probably damaging Het
Sema6a T A 18: 47,382,363 (GRCm39) H728L possibly damaging Het
Slc26a3 G T 12: 31,507,079 (GRCm39) A345S possibly damaging Het
Slc35d2 A G 13: 64,247,097 (GRCm39) V261A possibly damaging Het
Slc49a3 T C 5: 108,589,945 (GRCm39) T486A probably damaging Het
Ssmem1 A G 6: 30,519,513 (GRCm39) D66G probably damaging Het
Sult2a8 A T 7: 14,159,402 (GRCm39) N72K probably benign Het
Tbx10 T C 19: 4,046,921 (GRCm39) L108P probably damaging Het
Tex14 T C 11: 87,427,691 (GRCm39) S48P probably damaging Het
Tmie A G 9: 110,696,596 (GRCm39) L95P probably damaging Het
Tom1l2 C G 11: 60,161,259 (GRCm39) R84P probably damaging Het
Trpm3 T A 19: 22,866,799 (GRCm39) D543E possibly damaging Het
Vipr2 A C 12: 116,043,751 (GRCm39) R49S probably benign Het
Vps8 A T 16: 21,261,189 (GRCm39) S110C probably damaging Het
Zfp791 T A 8: 85,837,597 (GRCm39) N89I probably damaging Het
Other mutations in Itga11
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00933:Itga11 APN 9 62,676,587 (GRCm39) missense possibly damaging 0.58
IGL01108:Itga11 APN 9 62,664,903 (GRCm39) missense probably benign
IGL01348:Itga11 APN 9 62,651,861 (GRCm39) missense possibly damaging 0.83
IGL01739:Itga11 APN 9 62,681,399 (GRCm39) missense probably benign 0.03
IGL01918:Itga11 APN 9 62,680,278 (GRCm39) missense probably benign 0.05
IGL02237:Itga11 APN 9 62,663,057 (GRCm39) critical splice donor site probably null
IGL02418:Itga11 APN 9 62,651,914 (GRCm39) missense probably benign 0.30
IGL02451:Itga11 APN 9 62,642,635 (GRCm39) missense probably damaging 1.00
sneezy UTSW 9 62,639,391 (GRCm39) missense probably damaging 1.00
PIT4812001:Itga11 UTSW 9 62,639,475 (GRCm39) missense probably damaging 1.00
R0013:Itga11 UTSW 9 62,683,895 (GRCm39) missense possibly damaging 0.89
R0013:Itga11 UTSW 9 62,683,895 (GRCm39) missense possibly damaging 0.89
R0032:Itga11 UTSW 9 62,681,377 (GRCm39) missense probably benign 0.05
R0032:Itga11 UTSW 9 62,681,377 (GRCm39) missense probably benign 0.05
R0101:Itga11 UTSW 9 62,651,768 (GRCm39) missense probably damaging 1.00
R0114:Itga11 UTSW 9 62,667,584 (GRCm39) missense possibly damaging 0.85
R0114:Itga11 UTSW 9 62,642,575 (GRCm39) missense probably damaging 1.00
R0212:Itga11 UTSW 9 62,653,251 (GRCm39) missense probably benign 0.22
R0310:Itga11 UTSW 9 62,667,628 (GRCm39) missense probably damaging 1.00
R0455:Itga11 UTSW 9 62,604,243 (GRCm39) missense probably damaging 1.00
R0558:Itga11 UTSW 9 62,659,570 (GRCm39) missense probably benign 0.01
R0607:Itga11 UTSW 9 62,681,653 (GRCm39) missense probably benign 0.00
R0924:Itga11 UTSW 9 62,683,956 (GRCm39) missense probably benign 0.14
R1085:Itga11 UTSW 9 62,585,252 (GRCm39) missense probably benign 0.03
R1477:Itga11 UTSW 9 62,662,493 (GRCm39) missense probably benign
R1647:Itga11 UTSW 9 62,667,652 (GRCm39) missense probably benign 0.01
R1831:Itga11 UTSW 9 62,689,300 (GRCm39) missense probably damaging 1.00
R1880:Itga11 UTSW 9 62,585,231 (GRCm39) missense probably benign 0.06
R1934:Itga11 UTSW 9 62,651,796 (GRCm39) missense probably damaging 1.00
R2025:Itga11 UTSW 9 62,670,093 (GRCm39) missense probably damaging 1.00
R2046:Itga11 UTSW 9 62,634,979 (GRCm39) missense probably damaging 1.00
R2145:Itga11 UTSW 9 62,639,486 (GRCm39) splice site probably benign
R2922:Itga11 UTSW 9 62,675,912 (GRCm39) splice site probably benign
R3011:Itga11 UTSW 9 62,604,262 (GRCm39) missense probably damaging 0.99
R3158:Itga11 UTSW 9 62,676,560 (GRCm39) missense probably benign 0.02
R3809:Itga11 UTSW 9 62,678,664 (GRCm39) missense probably benign
R3836:Itga11 UTSW 9 62,676,565 (GRCm39) missense probably benign 0.00
R4051:Itga11 UTSW 9 62,662,933 (GRCm39) nonsense probably null
R4190:Itga11 UTSW 9 62,639,391 (GRCm39) missense probably damaging 1.00
R4510:Itga11 UTSW 9 62,668,870 (GRCm39) missense probably damaging 0.96
R4511:Itga11 UTSW 9 62,668,870 (GRCm39) missense probably damaging 0.96
R4678:Itga11 UTSW 9 62,642,639 (GRCm39) missense probably damaging 0.98
R4706:Itga11 UTSW 9 62,662,578 (GRCm39) missense possibly damaging 0.64
R4798:Itga11 UTSW 9 62,684,009 (GRCm39) splice site probably null
R4909:Itga11 UTSW 9 62,662,581 (GRCm39) missense probably damaging 1.00
R4915:Itga11 UTSW 9 62,659,530 (GRCm39) nonsense probably null
R4957:Itga11 UTSW 9 62,674,930 (GRCm39) missense probably benign 0.00
R4962:Itga11 UTSW 9 62,668,850 (GRCm39) nonsense probably null
R5081:Itga11 UTSW 9 62,662,478 (GRCm39) missense probably benign 0.13
R5265:Itga11 UTSW 9 62,644,694 (GRCm39) missense probably benign 0.05
R5308:Itga11 UTSW 9 62,663,051 (GRCm39) missense probably benign
R5398:Itga11 UTSW 9 62,653,205 (GRCm39) missense probably benign 0.21
R5717:Itga11 UTSW 9 62,659,531 (GRCm39) missense probably benign 0.26
R5885:Itga11 UTSW 9 62,670,132 (GRCm39) missense probably damaging 0.99
R5996:Itga11 UTSW 9 62,662,955 (GRCm39) missense probably benign 0.01
R6394:Itga11 UTSW 9 62,642,548 (GRCm39) splice site probably null
R6751:Itga11 UTSW 9 62,675,866 (GRCm39) missense probably benign 0.02
R7041:Itga11 UTSW 9 62,659,538 (GRCm39) missense probably damaging 1.00
R7264:Itga11 UTSW 9 62,653,190 (GRCm39) missense probably benign 0.02
R7509:Itga11 UTSW 9 62,689,222 (GRCm39) missense probably benign
R7601:Itga11 UTSW 9 62,604,208 (GRCm39) missense probably benign 0.18
R7615:Itga11 UTSW 9 62,651,300 (GRCm39) missense probably benign 0.00
R8263:Itga11 UTSW 9 62,604,262 (GRCm39) missense possibly damaging 0.86
R8285:Itga11 UTSW 9 62,659,540 (GRCm39) missense probably damaging 1.00
R8419:Itga11 UTSW 9 62,662,460 (GRCm39) missense possibly damaging 0.59
R8422:Itga11 UTSW 9 62,674,960 (GRCm39) missense probably benign 0.00
R8469:Itga11 UTSW 9 62,678,680 (GRCm39) missense probably benign 0.00
R8475:Itga11 UTSW 9 62,651,327 (GRCm39) missense probably damaging 1.00
R8871:Itga11 UTSW 9 62,668,823 (GRCm39) nonsense probably null
R8904:Itga11 UTSW 9 62,664,893 (GRCm39) missense probably benign
R8954:Itga11 UTSW 9 62,676,545 (GRCm39) missense possibly damaging 0.58
R8977:Itga11 UTSW 9 62,662,922 (GRCm39) missense probably damaging 0.98
R9011:Itga11 UTSW 9 62,662,909 (GRCm39) missense probably benign 0.43
R9038:Itga11 UTSW 9 62,675,039 (GRCm39) missense possibly damaging 0.90
R9089:Itga11 UTSW 9 62,678,662 (GRCm39) missense probably damaging 1.00
R9262:Itga11 UTSW 9 62,659,678 (GRCm39) splice site probably benign
R9327:Itga11 UTSW 9 62,638,034 (GRCm39) missense probably damaging 1.00
R9487:Itga11 UTSW 9 62,670,171 (GRCm39) missense probably benign 0.35
R9794:Itga11 UTSW 9 62,662,868 (GRCm39) missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TCCTGTTGACTGGAACTGTG -3'
(R):5'- GGAGTATCAGAGCCATGCTG -3'

Sequencing Primer
(F):5'- GGCTGAGCACTCTCTCTTAGAAG -3'
(R):5'- GTCTGTGAGACAGCTTCACTAGGAC -3'
Posted On 2015-10-21