Incidental Mutation 'R4713:Tmie'
ID353381
Institutional Source Beutler Lab
Gene Symbol Tmie
Ensembl Gene ENSMUSG00000049555
Gene Nametransmembrane inner ear
Synonyms5131400L21Rik, Mm.87012
MMRRC Submission 041601-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.055) question?
Stock #R4713 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location110865711-110880113 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 110867528 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 95 (L95P)
Ref Sequence ENSEMBL: ENSMUSP00000060148 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000050958] [ENSMUST00000051097]
Predicted Effect probably damaging
Transcript: ENSMUST00000050958
AA Change: L95P

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000060148
Gene: ENSMUSG00000049555
AA Change: L95P

DomainStartEndE-ValueType
transmembrane domain 12 31 N/A INTRINSIC
low complexity region 37 44 N/A INTRINSIC
transmembrane domain 57 79 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000051097
SMART Domains Protein: ENSMUSP00000059668
Gene: ENSMUSG00000048752

DomainStartEndE-ValueType
signal peptide 1 47 N/A INTRINSIC
low complexity region 112 127 N/A INTRINSIC
Tryp_SPc 172 407 2.87e-43 SMART
low complexity region 425 439 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000196027
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.7%
  • 20x: 94.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a transmembrane inner ear protein. Studies in mouse suggest that this gene is required for normal postnatal maturation of sensory hair cells in the cochlea, including correct development of stereocilia bundles. This gene is one of multiple genes responsible for recessive non-syndromic deafness (DFNB), also known as autosomal recessive nonsyndromic hearing loss (ARNSHL), the most common form of congenitally acquired inherited hearing impairment. [provided by RefSeq, Mar 2009]
PHENOTYPE: Mutations in this gene cause circling behavior and deafness in homozygous mice. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrb3 G T 1: 25,547,532 T360K probably damaging Het
AW551984 T C 9: 39,597,153 K356E probably benign Het
Bpifb2 T A 2: 153,881,193 V123E probably damaging Het
Cacna1a T G 8: 84,549,514 F532V probably damaging Het
Cct8 C A 16: 87,487,688 E204* probably null Het
Cd163 T A 6: 124,317,618 probably null Het
Cep152 C A 2: 125,587,948 A685S possibly damaging Het
Chdh A G 14: 30,036,841 D581G probably benign Het
Cnpy3 A C 17: 46,747,465 Y77* probably null Het
Col5a3 T C 9: 20,793,574 E762G unknown Het
Creb3 A G 4: 43,563,247 T115A probably benign Het
Dlat G T 9: 50,644,481 A412E probably benign Het
Dnah2 T C 11: 69,476,688 N1789S probably damaging Het
Dzank1 C T 2: 144,491,804 E370K probably benign Het
Eif3m A T 2: 105,006,839 probably null Het
Gimap8 A T 6: 48,658,986 M562L probably benign Het
Gm15448 G T 7: 3,822,681 Y396* probably null Het
Gprc6a T A 10: 51,631,457 probably benign Het
Gsr T G 8: 33,680,319 probably null Het
Gstcd A G 3: 132,983,099 V630A probably damaging Het
Hip1r T C 5: 123,989,980 I116T probably benign Het
Hivep3 A G 4: 120,131,803 E1817G probably damaging Het
Inpp5f A C 7: 128,663,725 T135P probably damaging Het
Ism2 A G 12: 87,285,027 silent Het
Itga11 A G 9: 62,765,788 D784G probably damaging Het
Itpr2 A G 6: 146,373,173 F837S probably damaging Het
Itpr2 T C 6: 146,396,958 E10G probably damaging Het
Knl1 A T 2: 119,069,137 K440* probably null Het
Lonp2 T C 8: 86,713,315 S648P probably damaging Het
Lrba T C 3: 86,359,868 S1622P probably benign Het
Lrp2 G T 2: 69,487,966 A2047D probably damaging Het
Mcm3 G A 1: 20,803,577 T773I probably benign Het
Mfsd7a T C 5: 108,442,079 T486A probably damaging Het
Mki67 A G 7: 135,695,469 V2612A probably benign Het
Mnx1 C A 5: 29,478,131 G49W probably damaging Het
Muc5b T A 7: 141,849,079 Y673* probably null Het
Myo15 A G 11: 60,479,930 H1172R probably benign Het
Myo1g T C 11: 6,516,080 K363R probably null Het
Ncoa4 T A 14: 32,176,641 C473S probably benign Het
Nefh T C 11: 4,939,656 T988A unknown Het
Nwd2 T A 5: 63,804,460 D462E probably benign Het
Olfr332 T C 11: 58,490,087 T223A probably benign Het
Plec T C 15: 76,181,067 E1466G unknown Het
Prl3d2 G T 13: 27,122,396 M35I probably benign Het
Reln T A 5: 22,152,463 I202F probably benign Het
Rhot1 T A 11: 80,225,602 D78E probably benign Het
Rsph3b T C 17: 6,905,129 probably null Het
Scn10a C T 9: 119,609,651 M1717I probably damaging Het
Sema6a T A 18: 47,249,296 H728L possibly damaging Het
Slc26a3 G T 12: 31,457,080 A345S possibly damaging Het
Slc35d2 A G 13: 64,099,283 V261A possibly damaging Het
Ssmem1 A G 6: 30,519,514 D66G probably damaging Het
Sult2a8 A T 7: 14,425,477 N72K probably benign Het
Tbx10 T C 19: 3,996,921 L108P probably damaging Het
Tex14 T C 11: 87,536,865 S48P probably damaging Het
Tom1l2 C G 11: 60,270,433 R84P probably damaging Het
Trpm3 T A 19: 22,889,435 D543E possibly damaging Het
Vipr2 A C 12: 116,080,131 R49S probably benign Het
Vps8 A T 16: 21,442,439 S110C probably damaging Het
Zfp791 T A 8: 85,110,968 N89I probably damaging Het
Other mutations in Tmie
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02363:Tmie APN 9 110870753 splice site probably benign
dinnerbell UTSW 9 110870681 missense possibly damaging 0.95
R4582:Tmie UTSW 9 110873797 missense probably benign 0.22
R4900:Tmie UTSW 9 110866933 missense possibly damaging 0.69
R6850:Tmie UTSW 9 110866912 missense possibly damaging 0.68
R7142:Tmie UTSW 9 110870681 missense possibly damaging 0.95
R7202:Tmie UTSW 9 110867564 missense probably damaging 0.96
R8029:Tmie UTSW 9 110867487 missense possibly damaging 0.52
Z1177:Tmie UTSW 9 110867465 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGCAGACACAGGTTCAATTGG -3'
(R):5'- CGTGCATCTGTGTAAAGTCAG -3'

Sequencing Primer
(F):5'- TTCAATTGGAACAGTGGGAGTG -3'
(R):5'- CTTTTGCAGAAATCTCCTGTGAG -3'
Posted On2015-10-21