Incidental Mutation 'R4713:Nefh'
ID353384
Institutional Source Beutler Lab
Gene Symbol Nefh
Ensembl Gene ENSMUSG00000020396
Gene Nameneurofilament, heavy polypeptide
SynonymsNF-H, NEFH, NF200
MMRRC Submission 041601-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4713 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location4938754-4948064 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 4939656 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 988 (T988A)
Ref Sequence ENSEMBL: ENSMUSP00000091061 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000093369]
Predicted Effect unknown
Transcript: ENSMUST00000093369
AA Change: T988A
SMART Domains Protein: ENSMUSP00000091061
Gene: ENSMUSG00000020396
AA Change: T988A

DomainStartEndE-ValueType
low complexity region 32 46 N/A INTRINSIC
low complexity region 49 64 N/A INTRINSIC
Filament 94 410 1.45e-109 SMART
low complexity region 470 515 N/A INTRINSIC
Pfam:DUF1388 519 545 1.8e-14 PFAM
Pfam:DUF1388 536 562 5.8e-15 PFAM
Pfam:DUF1388 542 569 2.7e-12 PFAM
Pfam:DUF1388 578 611 9.7e-10 PFAM
Pfam:DUF1388 602 629 4.9e-14 PFAM
Pfam:DUF1388 608 635 4.7e-14 PFAM
Pfam:DUF1388 626 653 1.4e-13 PFAM
Pfam:DUF1388 632 659 2.5e-13 PFAM
Pfam:DUF1388 656 683 4.4e-14 PFAM
Pfam:DUF1388 680 706 1.5e-12 PFAM
Pfam:DUF1388 700 730 5e-12 PFAM
Pfam:DUF1388 728 755 7.9e-14 PFAM
Pfam:DUF1388 752 779 4.7e-14 PFAM
Pfam:DUF1388 779 800 1.9e-9 PFAM
low complexity region 816 829 N/A INTRINSIC
low complexity region 858 948 N/A INTRINSIC
low complexity region 949 968 N/A INTRINSIC
low complexity region 976 1039 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.7%
  • 20x: 94.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Neurofilaments are type IV intermediate filament heteropolymers composed of light, medium, and heavy chains. Neurofilaments comprise the axoskeleton and functionally maintain neuronal caliber. They may also play a role in intracellular transport to axons and dendrites. This gene encodes the heavy neurofilament protein. This protein is commonly used as a biomarker of neuronal damage and susceptibility to amyotrophic lateral sclerosis (ALS) has been associated with mutations in this gene. [provided by RefSeq, Oct 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit decreased axon diameter and transport. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrb3 G T 1: 25,547,532 T360K probably damaging Het
AW551984 T C 9: 39,597,153 K356E probably benign Het
Bpifb2 T A 2: 153,881,193 V123E probably damaging Het
Cacna1a T G 8: 84,549,514 F532V probably damaging Het
Cct8 C A 16: 87,487,688 E204* probably null Het
Cd163 T A 6: 124,317,618 probably null Het
Cep152 C A 2: 125,587,948 A685S possibly damaging Het
Chdh A G 14: 30,036,841 D581G probably benign Het
Cnpy3 A C 17: 46,747,465 Y77* probably null Het
Col5a3 T C 9: 20,793,574 E762G unknown Het
Creb3 A G 4: 43,563,247 T115A probably benign Het
Dlat G T 9: 50,644,481 A412E probably benign Het
Dnah2 T C 11: 69,476,688 N1789S probably damaging Het
Dzank1 C T 2: 144,491,804 E370K probably benign Het
Eif3m A T 2: 105,006,839 probably null Het
Gimap8 A T 6: 48,658,986 M562L probably benign Het
Gm15448 G T 7: 3,822,681 Y396* probably null Het
Gprc6a T A 10: 51,631,457 probably benign Het
Gsr T G 8: 33,680,319 probably null Het
Gstcd A G 3: 132,983,099 V630A probably damaging Het
Hip1r T C 5: 123,989,980 I116T probably benign Het
Hivep3 A G 4: 120,131,803 E1817G probably damaging Het
Inpp5f A C 7: 128,663,725 T135P probably damaging Het
Ism2 A G 12: 87,285,027 silent Het
Itga11 A G 9: 62,765,788 D784G probably damaging Het
Itpr2 A G 6: 146,373,173 F837S probably damaging Het
Itpr2 T C 6: 146,396,958 E10G probably damaging Het
Knl1 A T 2: 119,069,137 K440* probably null Het
Lonp2 T C 8: 86,713,315 S648P probably damaging Het
Lrba T C 3: 86,359,868 S1622P probably benign Het
Lrp2 G T 2: 69,487,966 A2047D probably damaging Het
Mcm3 G A 1: 20,803,577 T773I probably benign Het
Mfsd7a T C 5: 108,442,079 T486A probably damaging Het
Mki67 A G 7: 135,695,469 V2612A probably benign Het
Mnx1 C A 5: 29,478,131 G49W probably damaging Het
Muc5b T A 7: 141,849,079 Y673* probably null Het
Myo15 A G 11: 60,479,930 H1172R probably benign Het
Myo1g T C 11: 6,516,080 K363R probably null Het
Ncoa4 T A 14: 32,176,641 C473S probably benign Het
Nwd2 T A 5: 63,804,460 D462E probably benign Het
Olfr332 T C 11: 58,490,087 T223A probably benign Het
Plec T C 15: 76,181,067 E1466G unknown Het
Prl3d2 G T 13: 27,122,396 M35I probably benign Het
Reln T A 5: 22,152,463 I202F probably benign Het
Rhot1 T A 11: 80,225,602 D78E probably benign Het
Rsph3b T C 17: 6,905,129 probably null Het
Scn10a C T 9: 119,609,651 M1717I probably damaging Het
Sema6a T A 18: 47,249,296 H728L possibly damaging Het
Slc26a3 G T 12: 31,457,080 A345S possibly damaging Het
Slc35d2 A G 13: 64,099,283 V261A possibly damaging Het
Ssmem1 A G 6: 30,519,514 D66G probably damaging Het
Sult2a8 A T 7: 14,425,477 N72K probably benign Het
Tbx10 T C 19: 3,996,921 L108P probably damaging Het
Tex14 T C 11: 87,536,865 S48P probably damaging Het
Tmie A G 9: 110,867,528 L95P probably damaging Het
Tom1l2 C G 11: 60,270,433 R84P probably damaging Het
Trpm3 T A 19: 22,889,435 D543E possibly damaging Het
Vipr2 A C 12: 116,080,131 R49S probably benign Het
Vps8 A T 16: 21,442,439 S110C probably damaging Het
Zfp791 T A 8: 85,110,968 N89I probably damaging Het
Other mutations in Nefh
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02931:Nefh APN 11 4941356 missense possibly damaging 0.71
IGL03025:Nefh APN 11 4945289 missense probably damaging 0.99
FR4340:Nefh UTSW 11 4941033 small insertion probably benign
FR4340:Nefh UTSW 11 4941038 small insertion probably benign
FR4340:Nefh UTSW 11 4941040 small insertion probably benign
R0041:Nefh UTSW 11 4945184 missense possibly damaging 0.92
R0149:Nefh UTSW 11 4940799 missense probably benign 0.39
R0361:Nefh UTSW 11 4940799 missense probably benign 0.39
R0531:Nefh UTSW 11 4940240 missense probably damaging 1.00
R1340:Nefh UTSW 11 4941002 small insertion probably benign
R1349:Nefh UTSW 11 4941010 small insertion probably benign
R1469:Nefh UTSW 11 4940066 missense probably benign 0.20
R1469:Nefh UTSW 11 4940066 missense probably benign 0.20
R1564:Nefh UTSW 11 4939878 missense unknown
R2165:Nefh UTSW 11 4943872 missense probably damaging 1.00
R2417:Nefh UTSW 11 4939479 missense unknown
R2906:Nefh UTSW 11 4940216 missense probably benign 0.15
R3750:Nefh UTSW 11 4939937 missense probably benign 0.33
R4298:Nefh UTSW 11 4940066 missense probably benign
R4462:Nefh UTSW 11 4941015 missense probably damaging 0.98
R4878:Nefh UTSW 11 4941333 missense probably damaging 0.98
R5423:Nefh UTSW 11 4940985 missense possibly damaging 0.59
R5648:Nefh UTSW 11 4945233 missense probably damaging 1.00
R5893:Nefh UTSW 11 4941323 missense probably damaging 1.00
R6459:Nefh UTSW 11 4939551 missense unknown
R7583:Nefh UTSW 11 4941089 missense probably damaging 0.96
R8557:Nefh UTSW 11 4941233 missense probably damaging 0.98
R8925:Nefh UTSW 11 4940530 small deletion probably benign
RF001:Nefh UTSW 11 4941030 small insertion probably benign
RF002:Nefh UTSW 11 4941047 small insertion probably benign
RF002:Nefh UTSW 11 4941050 small insertion probably benign
RF009:Nefh UTSW 11 4940997 small insertion probably benign
RF012:Nefh UTSW 11 4941030 small insertion probably benign
RF012:Nefh UTSW 11 4941032 small insertion probably benign
RF012:Nefh UTSW 11 4941055 small insertion probably benign
RF013:Nefh UTSW 11 4941032 small insertion probably benign
RF016:Nefh UTSW 11 4941022 small insertion probably benign
RF016:Nefh UTSW 11 4941023 small insertion probably benign
RF025:Nefh UTSW 11 4941003 small insertion probably benign
RF025:Nefh UTSW 11 4941029 small insertion probably benign
RF028:Nefh UTSW 11 4941012 small insertion probably benign
RF028:Nefh UTSW 11 4941029 small insertion probably benign
RF033:Nefh UTSW 11 4941029 frame shift probably null
RF033:Nefh UTSW 11 4941039 small insertion probably benign
RF035:Nefh UTSW 11 4941039 small insertion probably benign
RF036:Nefh UTSW 11 4941010 small insertion probably benign
RF036:Nefh UTSW 11 4941016 small insertion probably benign
RF036:Nefh UTSW 11 4941036 small insertion probably benign
RF036:Nefh UTSW 11 4941048 small insertion probably benign
RF037:Nefh UTSW 11 4940999 small insertion probably benign
RF037:Nefh UTSW 11 4941046 small insertion probably benign
RF037:Nefh UTSW 11 4941054 small insertion probably benign
RF038:Nefh UTSW 11 4941012 small insertion probably benign
RF038:Nefh UTSW 11 4941018 small insertion probably benign
RF038:Nefh UTSW 11 4941019 small insertion probably benign
RF038:Nefh UTSW 11 4941027 small insertion probably benign
RF038:Nefh UTSW 11 4941029 small insertion probably benign
RF038:Nefh UTSW 11 4941040 small insertion probably benign
RF039:Nefh UTSW 11 4941007 small insertion probably benign
RF041:Nefh UTSW 11 4941039 small insertion probably benign
RF043:Nefh UTSW 11 4941016 small insertion probably benign
RF044:Nefh UTSW 11 4941016 small insertion probably benign
RF044:Nefh UTSW 11 4941021 small insertion probably benign
RF044:Nefh UTSW 11 4941023 small insertion probably benign
RF047:Nefh UTSW 11 4941038 small insertion probably benign
RF048:Nefh UTSW 11 4941003 small insertion probably benign
RF048:Nefh UTSW 11 4941007 small insertion probably benign
RF049:Nefh UTSW 11 4940997 small insertion probably benign
RF051:Nefh UTSW 11 4941054 small insertion probably benign
RF053:Nefh UTSW 11 4941014 nonsense probably null
RF054:Nefh UTSW 11 4941048 small insertion probably benign
RF055:Nefh UTSW 11 4941004 small insertion probably benign
RF058:Nefh UTSW 11 4941021 small insertion probably benign
RF060:Nefh UTSW 11 4941050 small insertion probably benign
RF060:Nefh UTSW 11 4941052 small insertion probably benign
RF062:Nefh UTSW 11 4941028 small insertion probably benign
T0975:Nefh UTSW 11 4940151 missense probably benign 0.00
Z1186:Nefh UTSW 11 4940530 small deletion probably benign
Predicted Primers PCR Primer
(F):5'- ACCTTGGCCTCCATTTTGGG -3'
(R):5'- AGGTGAAGTCCCCTGTGAAG -3'

Sequencing Primer
(F):5'- TGGGCTTCTCCTCAGGC -3'
(R):5'- TCCCCTGTGAAGGAGGAG -3'
Posted On2015-10-21