Incidental Mutation 'R4713:Tom1l2'
ID 353386
Institutional Source Beutler Lab
Gene Symbol Tom1l2
Ensembl Gene ENSMUSG00000000538
Gene Name target of myb1-like 2 (chicken)
Synonyms A730055F12Rik, myb1-like protein 2, 2900016I08Rik
MMRRC Submission 041601-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.332) question?
Stock # R4713 (G1)
Quality Score 222
Status Not validated
Chromosome 11
Chromosomal Location 60226714-60352905 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to G at 60270433 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Arginine to Proline at position 84 (R84P)
Ref Sequence ENSEMBL: ENSMUSP00000099744 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000064019] [ENSMUST00000093046] [ENSMUST00000093048] [ENSMUST00000095254] [ENSMUST00000102682] [ENSMUST00000102683]
AlphaFold Q5SRX1
Predicted Effect probably damaging
Transcript: ENSMUST00000064019
AA Change: R84P

PolyPhen 2 Score 0.978 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000063414
Gene: ENSMUSG00000000538
AA Change: R84P

DomainStartEndE-ValueType
VHS 13 148 1.88e-68 SMART
low complexity region 187 202 N/A INTRINSIC
Pfam:GAT 216 317 1.7e-36 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000093046
SMART Domains Protein: ENSMUSP00000090734
Gene: ENSMUSG00000000538

DomainStartEndE-ValueType
Pfam:VHS 7 73 1.3e-19 PFAM
low complexity region 137 152 N/A INTRINSIC
Pfam:GAT 166 267 3e-36 PFAM
low complexity region 428 443 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000093048
AA Change: R84P

PolyPhen 2 Score 0.890 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000090736
Gene: ENSMUSG00000000538
AA Change: R84P

DomainStartEndE-ValueType
VHS 13 154 1.8e-47 SMART
Pfam:GAT 171 272 3e-36 PFAM
low complexity region 433 448 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000095254
AA Change: R84P

PolyPhen 2 Score 0.978 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000092884
Gene: ENSMUSG00000000538
AA Change: R84P

DomainStartEndE-ValueType
VHS 13 148 1.88e-68 SMART
low complexity region 187 202 N/A INTRINSIC
Pfam:GAT 216 317 2e-36 PFAM
low complexity region 458 473 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000102682
AA Change: R84P

PolyPhen 2 Score 0.978 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000099743
Gene: ENSMUSG00000000538
AA Change: R84P

DomainStartEndE-ValueType
VHS 13 148 1.88e-68 SMART
low complexity region 187 202 N/A INTRINSIC
Pfam:GAT 216 317 1.7e-36 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000102683
AA Change: R84P

PolyPhen 2 Score 0.978 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000099744
Gene: ENSMUSG00000000538
AA Change: R84P

DomainStartEndE-ValueType
VHS 13 148 1.88e-68 SMART
low complexity region 187 202 N/A INTRINSIC
Pfam:GAT 232 308 1e-26 PFAM
low complexity region 478 493 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142225
Meta Mutation Damage Score 0.8597 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.7%
  • 20x: 94.0%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a hypomorphic gene trap allele show malocclusion, kyphosis, hydrocephaly, patchy hair, splenomegaly, high B- and T-cell counts, thrombopenia, impaired humoral responses, a high frequency of infections and tumors, renal cysts, skin lesions, freezing behavior and sporadic bleeding. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrb3 G T 1: 25,547,532 T360K probably damaging Het
AW551984 T C 9: 39,597,153 K356E probably benign Het
Bpifb2 T A 2: 153,881,193 V123E probably damaging Het
Cacna1a T G 8: 84,549,514 F532V probably damaging Het
Cct8 C A 16: 87,487,688 E204* probably null Het
Cd163 T A 6: 124,317,618 probably null Het
Cep152 C A 2: 125,587,948 A685S possibly damaging Het
Chdh A G 14: 30,036,841 D581G probably benign Het
Cnpy3 A C 17: 46,747,465 Y77* probably null Het
Col5a3 T C 9: 20,793,574 E762G unknown Het
Creb3 A G 4: 43,563,247 T115A probably benign Het
Dlat G T 9: 50,644,481 A412E probably benign Het
Dnah2 T C 11: 69,476,688 N1789S probably damaging Het
Dzank1 C T 2: 144,491,804 E370K probably benign Het
Eif3m A T 2: 105,006,839 probably null Het
Gimap8 A T 6: 48,658,986 M562L probably benign Het
Gm15448 G T 7: 3,822,681 Y396* probably null Het
Gprc6a T A 10: 51,631,457 probably benign Het
Gsr T G 8: 33,680,319 probably null Het
Gstcd A G 3: 132,983,099 V630A probably damaging Het
Hip1r T C 5: 123,989,980 I116T probably benign Het
Hivep3 A G 4: 120,131,803 E1817G probably damaging Het
Inpp5f A C 7: 128,663,725 T135P probably damaging Het
Ism2 A G 12: 87,285,027 silent Het
Itga11 A G 9: 62,765,788 D784G probably damaging Het
Itpr2 A G 6: 146,373,173 F837S probably damaging Het
Itpr2 T C 6: 146,396,958 E10G probably damaging Het
Knl1 A T 2: 119,069,137 K440* probably null Het
Lonp2 T C 8: 86,713,315 S648P probably damaging Het
Lrba T C 3: 86,359,868 S1622P probably benign Het
Lrp2 G T 2: 69,487,966 A2047D probably damaging Het
Mcm3 G A 1: 20,803,577 T773I probably benign Het
Mfsd7a T C 5: 108,442,079 T486A probably damaging Het
Mki67 A G 7: 135,695,469 V2612A probably benign Het
Mnx1 C A 5: 29,478,131 G49W probably damaging Het
Muc5b T A 7: 141,849,079 Y673* probably null Het
Myo15 A G 11: 60,479,930 H1172R probably benign Het
Myo1g T C 11: 6,516,080 K363R probably null Het
Ncoa4 T A 14: 32,176,641 C473S probably benign Het
Nefh T C 11: 4,939,656 T988A unknown Het
Nwd2 T A 5: 63,804,460 D462E probably benign Het
Olfr332 T C 11: 58,490,087 T223A probably benign Het
Plec T C 15: 76,181,067 E1466G unknown Het
Prl3d2 G T 13: 27,122,396 M35I probably benign Het
Reln T A 5: 22,152,463 I202F probably benign Het
Rhot1 T A 11: 80,225,602 D78E probably benign Het
Rsph3b T C 17: 6,905,129 probably null Het
Scn10a C T 9: 119,609,651 M1717I probably damaging Het
Sema6a T A 18: 47,249,296 H728L possibly damaging Het
Slc26a3 G T 12: 31,457,080 A345S possibly damaging Het
Slc35d2 A G 13: 64,099,283 V261A possibly damaging Het
Ssmem1 A G 6: 30,519,514 D66G probably damaging Het
Sult2a8 A T 7: 14,425,477 N72K probably benign Het
Tbx10 T C 19: 3,996,921 L108P probably damaging Het
Tex14 T C 11: 87,536,865 S48P probably damaging Het
Tmie A G 9: 110,867,528 L95P probably damaging Het
Trpm3 T A 19: 22,889,435 D543E possibly damaging Het
Vipr2 A C 12: 116,080,131 R49S probably benign Het
Vps8 A T 16: 21,442,439 S110C probably damaging Het
Zfp791 T A 8: 85,110,968 N89I probably damaging Het
Other mutations in Tom1l2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00648:Tom1l2 APN 11 60261116 missense possibly damaging 0.93
IGL01459:Tom1l2 APN 11 60280269 missense probably damaging 1.00
IGL02990:Tom1l2 APN 11 60230236 missense probably damaging 1.00
R0025:Tom1l2 UTSW 11 60230134 missense probably damaging 0.96
R0025:Tom1l2 UTSW 11 60230134 missense probably damaging 0.96
R4456:Tom1l2 UTSW 11 60352815 unclassified probably benign
R4627:Tom1l2 UTSW 11 60242707 critical splice donor site probably null
R4695:Tom1l2 UTSW 11 60270433 missense probably damaging 0.98
R4731:Tom1l2 UTSW 11 60270433 missense probably damaging 0.98
R4788:Tom1l2 UTSW 11 60249018 missense probably damaging 1.00
R4937:Tom1l2 UTSW 11 60258918 missense probably damaging 1.00
R5320:Tom1l2 UTSW 11 60242822 nonsense probably null
R5367:Tom1l2 UTSW 11 60241808 missense probably benign 0.00
R6158:Tom1l2 UTSW 11 60232927 missense probably damaging 1.00
R6944:Tom1l2 UTSW 11 60248991 missense probably damaging 0.98
R7335:Tom1l2 UTSW 11 60245165 missense probably benign 0.00
R7356:Tom1l2 UTSW 11 60249027 missense probably damaging 0.99
R7376:Tom1l2 UTSW 11 60261200 missense probably benign
R7544:Tom1l2 UTSW 11 60280214 small deletion probably benign
R7760:Tom1l2 UTSW 11 60274965 missense probably benign
R9200:Tom1l2 UTSW 11 60230116 missense probably benign 0.37
R9291:Tom1l2 UTSW 11 60262730 missense probably benign 0.09
R9394:Tom1l2 UTSW 11 60241889 missense probably benign 0.00
R9514:Tom1l2 UTSW 11 60262660 missense probably damaging 0.96
R9622:Tom1l2 UTSW 11 60261116 missense possibly damaging 0.93
R9625:Tom1l2 UTSW 11 60270451 missense probably damaging 1.00
Z1186:Tom1l2 UTSW 11 60241856 missense probably benign 0.01
Z1187:Tom1l2 UTSW 11 60241856 missense probably benign 0.01
Z1188:Tom1l2 UTSW 11 60241856 missense probably benign 0.01
Z1189:Tom1l2 UTSW 11 60241856 missense probably benign 0.01
Z1190:Tom1l2 UTSW 11 60241856 missense probably benign 0.01
Z1191:Tom1l2 UTSW 11 60241856 missense probably benign 0.01
Z1192:Tom1l2 UTSW 11 60241856 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TGAGCGTGTATCACAGTCCC -3'
(R):5'- AGTCAACACAGGATTGTCATTCCC -3'

Sequencing Primer
(F):5'- GTGTATCACAGTCCCCATCTTACAG -3'
(R):5'- CACAGGATTGTCATTCCCAAGGAAG -3'
Posted On 2015-10-21