Mutagenetix > Incidental Mutations

Incidental Mutation 'R4713:Tex14'

353391

Institutional Source

Beutler Lab

Gene Symbol

Tex14

Ensembl Gene

ENSMUSG00000010342

Gene Name

testis expressed gene 14

Synonyms

MMRRC Submission

041601-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.193) question?

Stock #

R4713 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

87405065-87555823 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 87536865 bp

Zygosity

Heterozygous

Amino Acid Change

Serine to Proline at position 48 (S48P)

Ref Sequence

ENSEMBL: ENSMUSP00000117564 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000060835] [ENSMUST00000100657] [ENSMUST00000131973]

Predicted Effect

probably benign
Transcript: ENSMUST00000060835
AA Change: S1228P

PolyPhen 2 Score 0.019 (Sensitivity: 0.95; Specificity: 0.80)

SMART Domains

Protein: ENSMUSP00000054444
Gene: ENSMUSG00000010342
AA Change: S1228P

Domain	Start	End	E-Value	Type
ANK	22	51	7.99e2	SMART
ANK	55	84	6.36e-3	SMART
ANK	88	117	3.49e0	SMART
Pfam:Pkinase	251	504	3.5e-19	PFAM
Pfam:Pkinase_Tyr	254	503	8.1e-28	PFAM
coiled coil region	659	684	N/A	INTRINSIC
coiled coil region	740	776	N/A	INTRINSIC
low complexity region	1219	1236	N/A	INTRINSIC
coiled coil region	1289	1309	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000100657

Predicted Effect

probably damaging
Transcript: ENSMUST00000131973
AA Change: S48P

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000117564
Gene: ENSMUSG00000010342
AA Change: S48P

Domain	Start	End	E-Value	Type
low complexity region	39	56	N/A	INTRINSIC

Coding Region Coverage

1x: 99.1%
3x: 98.5%
10x: 96.7%
20x: 94.0%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is necessary for intercellular bridges in germ cells, which are required for spermatogenesis. Three transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Jan 2011]
PHENOTYPE: Males homozygous for a targeted allele are infertile due to spermatogenic failure. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 60 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adgrb3	G	T	1: 25,547,532	T360K	probably damaging	Het
AW551984	T	C	9: 39,597,153	K356E	probably benign	Het
Bpifb2	T	A	2: 153,881,193	V123E	probably damaging	Het
Cacna1a	T	G	8: 84,549,514	F532V	probably damaging	Het
Cct8	C	A	16: 87,487,688	E204*	probably null	Het
Cd163	T	A	6: 124,317,618		probably null	Het
Cep152	C	A	2: 125,587,948	A685S	possibly damaging	Het
Chdh	A	G	14: 30,036,841	D581G	probably benign	Het
Cnpy3	A	C	17: 46,747,465	Y77*	probably null	Het
Col5a3	T	C	9: 20,793,574	E762G	unknown	Het
Creb3	A	G	4: 43,563,247	T115A	probably benign	Het
Dlat	G	T	9: 50,644,481	A412E	probably benign	Het
Dnah2	T	C	11: 69,476,688	N1789S	probably damaging	Het
Dzank1	C	T	2: 144,491,804	E370K	probably benign	Het
Eif3m	A	T	2: 105,006,839		probably null	Het
Gimap8	A	T	6: 48,658,986	M562L	probably benign	Het
Gm15448	G	T	7: 3,822,681	Y396*	probably null	Het
Gprc6a	T	A	10: 51,631,457		probably benign	Het
Gsr	T	G	8: 33,680,319		probably null	Het
Gstcd	A	G	3: 132,983,099	V630A	probably damaging	Het
Hip1r	T	C	5: 123,989,980	I116T	probably benign	Het
Hivep3	A	G	4: 120,131,803	E1817G	probably damaging	Het
Inpp5f	A	C	7: 128,663,725	T135P	probably damaging	Het
Ism2	A	G	12: 87,285,027		silent	Het
Itga11	A	G	9: 62,765,788	D784G	probably damaging	Het
Itpr2	A	G	6: 146,373,173	F837S	probably damaging	Het
Itpr2	T	C	6: 146,396,958	E10G	probably damaging	Het
Knl1	A	T	2: 119,069,137	K440*	probably null	Het
Lonp2	T	C	8: 86,713,315	S648P	probably damaging	Het
Lrba	T	C	3: 86,359,868	S1622P	probably benign	Het
Lrp2	G	T	2: 69,487,966	A2047D	probably damaging	Het
Mcm3	G	A	1: 20,803,577	T773I	probably benign	Het
Mfsd7a	T	C	5: 108,442,079	T486A	probably damaging	Het
Mki67	A	G	7: 135,695,469	V2612A	probably benign	Het
Mnx1	C	A	5: 29,478,131	G49W	probably damaging	Het
Muc5b	T	A	7: 141,849,079	Y673*	probably null	Het
Myo15	A	G	11: 60,479,930	H1172R	probably benign	Het
Myo1g	T	C	11: 6,516,080	K363R	probably null	Het
Ncoa4	T	A	14: 32,176,641	C473S	probably benign	Het
Nefh	T	C	11: 4,939,656	T988A	unknown	Het
Nwd2	T	A	5: 63,804,460	D462E	probably benign	Het
Olfr332	T	C	11: 58,490,087	T223A	probably benign	Het
Plec	T	C	15: 76,181,067	E1466G	unknown	Het
Prl3d2	G	T	13: 27,122,396	M35I	probably benign	Het
Reln	T	A	5: 22,152,463	I202F	probably benign	Het
Rhot1	T	A	11: 80,225,602	D78E	probably benign	Het
Rsph3b	T	C	17: 6,905,129		probably null	Het
Scn10a	C	T	9: 119,609,651	M1717I	probably damaging	Het
Sema6a	T	A	18: 47,249,296	H728L	possibly damaging	Het
Slc26a3	G	T	12: 31,457,080	A345S	possibly damaging	Het
Slc35d2	A	G	13: 64,099,283	V261A	possibly damaging	Het
Ssmem1	A	G	6: 30,519,514	D66G	probably damaging	Het
Sult2a8	A	T	7: 14,425,477	N72K	probably benign	Het
Tbx10	T	C	19: 3,996,921	L108P	probably damaging	Het
Tmie	A	G	9: 110,867,528	L95P	probably damaging	Het
Tom1l2	C	G	11: 60,270,433	R84P	probably damaging	Het
Trpm3	T	A	19: 22,889,435	D543E	possibly damaging	Het
Vipr2	A	C	12: 116,080,131	R49S	probably benign	Het
Vps8	A	T	16: 21,442,439	S110C	probably damaging	Het
Zfp791	T	A	8: 85,110,968	N89I	probably damaging	Het

Other mutations in Tex14

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00272:Tex14	APN	11	87535643	missense	probably damaging	0.98
IGL00494:Tex14	APN	11	87555484	missense	probably damaging	1.00
IGL01604:Tex14	APN	11	87509698	missense	possibly damaging	0.63
IGL02690:Tex14	APN	11	87486274	missense	probably benign	0.11
IGL02888:Tex14	APN	11	87527912	critical splice donor site	probably null
IGL03073:Tex14	APN	11	87535609	missense	probably damaging	0.99
IGL03109:Tex14	APN	11	87543365	missense	probably damaging	1.00
IGL03047:Tex14	UTSW	11	87536704	missense	probably damaging	1.00
R0141:Tex14	UTSW	11	87493031	splice site	probably null
R0455:Tex14	UTSW	11	87514305	missense	possibly damaging	0.93
R0624:Tex14	UTSW	11	87520699	missense	probably benign	0.19
R0718:Tex14	UTSW	11	87499613	missense	probably benign	0.20
R1077:Tex14	UTSW	11	87519745	splice site	probably benign
R1118:Tex14	UTSW	11	87522517	missense	probably benign	0.07
R1120:Tex14	UTSW	11	87538676	splice site	probably benign
R1168:Tex14	UTSW	11	87536742	missense	probably benign	0.11
R1190:Tex14	UTSW	11	87495108	splice site	probably null
R1470:Tex14	UTSW	11	87549529	splice site	probably benign
R1563:Tex14	UTSW	11	87536808	missense	probably damaging	0.99
R1607:Tex14	UTSW	11	87554928	missense	probably damaging	1.00
R1696:Tex14	UTSW	11	87511545	missense	possibly damaging	0.49
R1873:Tex14	UTSW	11	87499605	missense	probably damaging	1.00
R1894:Tex14	UTSW	11	87474448	missense	probably damaging	1.00
R1911:Tex14	UTSW	11	87495035	missense	probably damaging	1.00
R1955:Tex14	UTSW	11	87509621	missense	probably damaging	1.00
R1971:Tex14	UTSW	11	87511605	missense	probably damaging	1.00
R1990:Tex14	UTSW	11	87549470	missense	probably damaging	1.00
R1991:Tex14	UTSW	11	87549470	missense	probably damaging	1.00
R1993:Tex14	UTSW	11	87536755	missense	possibly damaging	0.57
R2106:Tex14	UTSW	11	87486250	missense	possibly damaging	0.47
R2118:Tex14	UTSW	11	87519743	splice site	probably benign
R2860:Tex14	UTSW	11	87474417	missense	probably damaging	1.00
R2861:Tex14	UTSW	11	87474417	missense	probably damaging	1.00
R4016:Tex14	UTSW	11	87538623	splice site	probably null
R4089:Tex14	UTSW	11	87512203	missense	probably damaging	1.00
R4158:Tex14	UTSW	11	87516769	missense	probably benign	0.06
R4533:Tex14	UTSW	11	87536829	nonsense	probably null
R4758:Tex14	UTSW	11	87514485	missense	probably benign	0.00
R4880:Tex14	UTSW	11	87486295	missense	possibly damaging	0.95
R4953:Tex14	UTSW	11	87536901	critical splice donor site	probably null
R5092:Tex14	UTSW	11	87514842	missense	probably benign	0.03
R5119:Tex14	UTSW	11	87433813	missense	probably damaging	1.00
R5322:Tex14	UTSW	11	87511472	missense	probably benign	0.04
R5470:Tex14	UTSW	11	87551604	missense	probably damaging	0.99
R5607:Tex14	UTSW	11	87522578	missense	probably benign	0.00
R5642:Tex14	UTSW	11	87514220	missense	probably benign
R5643:Tex14	UTSW	11	87535626	missense	probably damaging	1.00
R5786:Tex14	UTSW	11	87514295	missense	probably damaging	0.97
R6478:Tex14	UTSW	11	87514373	missense	probably benign
R6560:Tex14	UTSW	11	87497862	missense	possibly damaging	0.95
R6661:Tex14	UTSW	11	87495016	missense	probably damaging	1.00
R7037:Tex14	UTSW	11	87497915	missense	probably damaging	1.00
R7156:Tex14	UTSW	11	87484719	missense	probably damaging	0.99
R7465:Tex14	UTSW	11	87514430	missense	possibly damaging	0.48
R7675:Tex14	UTSW	11	87509678	missense	probably damaging	1.00
R7725:Tex14	UTSW	11	87495042	missense	probably damaging	0.99
R7911:Tex14	UTSW	11	87533602	critical splice donor site	probably null
R8015:Tex14	UTSW	11	87509600	missense	probably benign	0.13
R8226:Tex14	UTSW	11	87484759	missense	probably damaging	0.96
R8283:Tex14	UTSW	11	87474415	missense	probably damaging	1.00
R8292:Tex14	UTSW	11	87497838	missense	probably damaging	1.00
R8833:Tex14	UTSW	11	87493052	missense	probably benign	0.22
RF018:Tex14	UTSW	11	87514746	missense	probably benign	0.01
X0017:Tex14	UTSW	11	87535549	nonsense	probably null
Z1176:Tex14	UTSW	11	87484807	missense	probably benign	0.08
Z1176:Tex14	UTSW	11	87499593	missense	possibly damaging	0.95
Z1177:Tex14	UTSW	11	87514155	missense	probably damaging	0.96

Predicted Primers

PCR Primer
(F):5'- AGTCGATTTCTTCAGCTGCTAG -3'
(R):5'- AATGAGCTCTCCCTGCAACC -3'

Sequencing Primer
(F):5'- GCTGCTAGTCACTATGAAGACTGC -3'
(R):5'- TTCCACAATGCAGTCTCTGGAGAG -3'

Posted On

2015-10-21