Incidental Mutation 'R4713:Slc26a3'
ID 353392
Institutional Source Beutler Lab
Gene Symbol Slc26a3
Ensembl Gene ENSMUSG00000001225
Gene Name solute carrier family 26, member 3
Synonyms 9130013M11Rik, 9030623B18Rik, Dra
MMRRC Submission 041601-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.770) question?
Stock # R4713 (G1)
Quality Score 225
Status Not validated
Chromosome 12
Chromosomal Location 31483141-31523921 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to T at 31507079 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Alanine to Serine at position 345 (A345S)
Ref Sequence ENSEMBL: ENSMUSP00000001254 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001254] [ENSMUST00000110854] [ENSMUST00000171616]
AlphaFold Q9WVC8
Predicted Effect possibly damaging
Transcript: ENSMUST00000001254
AA Change: A345S

PolyPhen 2 Score 0.750 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000001254
Gene: ENSMUSG00000001225
AA Change: A345S

DomainStartEndE-ValueType
Pfam:Sulfate_transp 73 468 3.1e-115 PFAM
low complexity region 475 481 N/A INTRINSIC
Pfam:STAS 519 709 2e-40 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000110854
Predicted Effect noncoding transcript
Transcript: ENSMUST00000165816
Predicted Effect noncoding transcript
Transcript: ENSMUST00000168209
Predicted Effect probably benign
Transcript: ENSMUST00000171616
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.7%
  • 20x: 94.0%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the solute carrier/sulfate transporter family. The encoded protein is predominantly expressed in the intestine where it is essential for chloride absorption. Disruption of this gene results in chloride-rich diarrhea and compensatory up-regulation of ion-absorbing transporters. [provided by RefSeq, Dec 2012]
PHENOTYPE: Homozygotes for a null allele display partial postnatal lethality; survivors are small and show lower luminal Cl-/HCO3- exchange activity, acidic chloridorrhea, volume depletion, upregulation of ion transporters, dilated colons, higher crypt proliferation and plasma aldosterone, and premature death. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrb3 G T 1: 25,586,613 (GRCm39) T360K probably damaging Het
AW551984 T C 9: 39,508,449 (GRCm39) K356E probably benign Het
Bpifb2 T A 2: 153,723,113 (GRCm39) V123E probably damaging Het
Cacna1a T G 8: 85,276,143 (GRCm39) F532V probably damaging Het
Cct8 C A 16: 87,284,576 (GRCm39) E204* probably null Het
Cd163 T A 6: 124,294,577 (GRCm39) probably null Het
Cep152 C A 2: 125,429,868 (GRCm39) A685S possibly damaging Het
Chdh A G 14: 29,758,798 (GRCm39) D581G probably benign Het
Cnpy3 A C 17: 47,058,391 (GRCm39) Y77* probably null Het
Col5a3 T C 9: 20,704,870 (GRCm39) E762G unknown Het
Creb3 A G 4: 43,563,247 (GRCm39) T115A probably benign Het
Dlat G T 9: 50,555,781 (GRCm39) A412E probably benign Het
Dnah2 T C 11: 69,367,514 (GRCm39) N1789S probably damaging Het
Dzank1 C T 2: 144,333,724 (GRCm39) E370K probably benign Het
Eif3m A T 2: 104,837,184 (GRCm39) probably null Het
Gimap8 A T 6: 48,635,920 (GRCm39) M562L probably benign Het
Gprc6a T A 10: 51,507,553 (GRCm39) probably benign Het
Gsr T G 8: 34,170,347 (GRCm39) probably null Het
Gstcd A G 3: 132,688,860 (GRCm39) V630A probably damaging Het
Hip1r T C 5: 124,128,043 (GRCm39) I116T probably benign Het
Hivep3 A G 4: 119,989,000 (GRCm39) E1817G probably damaging Het
Inpp5f A C 7: 128,265,449 (GRCm39) T135P probably damaging Het
Ism2 A G 12: 87,331,801 (GRCm39) silent Het
Itga11 A G 9: 62,673,070 (GRCm39) D784G probably damaging Het
Itpr2 A G 6: 146,274,671 (GRCm39) F837S probably damaging Het
Itpr2 T C 6: 146,298,456 (GRCm39) E10G probably damaging Het
Knl1 A T 2: 118,899,618 (GRCm39) K440* probably null Het
Lonp2 T C 8: 87,439,943 (GRCm39) S648P probably damaging Het
Lrba T C 3: 86,267,175 (GRCm39) S1622P probably benign Het
Lrp2 G T 2: 69,318,310 (GRCm39) A2047D probably damaging Het
Mcm3 G A 1: 20,873,801 (GRCm39) T773I probably benign Het
Mki67 A G 7: 135,297,198 (GRCm39) V2612A probably benign Het
Mnx1 C A 5: 29,683,129 (GRCm39) G49W probably damaging Het
Muc5b T A 7: 141,402,816 (GRCm39) Y673* probably null Het
Myo15a A G 11: 60,370,756 (GRCm39) H1172R probably benign Het
Myo1g T C 11: 6,466,080 (GRCm39) K363R probably null Het
Ncoa4 T A 14: 31,898,598 (GRCm39) C473S probably benign Het
Nefh T C 11: 4,889,656 (GRCm39) T988A unknown Het
Nwd2 T A 5: 63,961,803 (GRCm39) D462E probably benign Het
Or2av9 T C 11: 58,380,913 (GRCm39) T223A probably benign Het
Pira13 G T 7: 3,825,680 (GRCm39) Y396* probably null Het
Plec T C 15: 76,065,267 (GRCm39) E1466G unknown Het
Prl3d2 G T 13: 27,306,379 (GRCm39) M35I probably benign Het
Reln T A 5: 22,357,461 (GRCm39) I202F probably benign Het
Rhot1 T A 11: 80,116,428 (GRCm39) D78E probably benign Het
Rsph3b T C 17: 7,172,528 (GRCm39) probably null Het
Scn10a C T 9: 119,438,717 (GRCm39) M1717I probably damaging Het
Sema6a T A 18: 47,382,363 (GRCm39) H728L possibly damaging Het
Slc35d2 A G 13: 64,247,097 (GRCm39) V261A possibly damaging Het
Slc49a3 T C 5: 108,589,945 (GRCm39) T486A probably damaging Het
Ssmem1 A G 6: 30,519,513 (GRCm39) D66G probably damaging Het
Sult2a8 A T 7: 14,159,402 (GRCm39) N72K probably benign Het
Tbx10 T C 19: 4,046,921 (GRCm39) L108P probably damaging Het
Tex14 T C 11: 87,427,691 (GRCm39) S48P probably damaging Het
Tmie A G 9: 110,696,596 (GRCm39) L95P probably damaging Het
Tom1l2 C G 11: 60,161,259 (GRCm39) R84P probably damaging Het
Trpm3 T A 19: 22,866,799 (GRCm39) D543E possibly damaging Het
Vipr2 A C 12: 116,043,751 (GRCm39) R49S probably benign Het
Vps8 A T 16: 21,261,189 (GRCm39) S110C probably damaging Het
Zfp791 T A 8: 85,837,597 (GRCm39) N89I probably damaging Het
Other mutations in Slc26a3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01446:Slc26a3 APN 12 31,502,490 (GRCm39) splice site probably benign
IGL01717:Slc26a3 APN 12 31,513,476 (GRCm39) missense probably benign 0.11
IGL02151:Slc26a3 APN 12 31,497,830 (GRCm39) missense probably damaging 0.99
IGL02374:Slc26a3 APN 12 31,520,832 (GRCm39) splice site probably benign
IGL02445:Slc26a3 APN 12 31,507,051 (GRCm39) missense possibly damaging 0.65
IGL02526:Slc26a3 APN 12 31,507,095 (GRCm39) missense probably damaging 1.00
IGL02831:Slc26a3 APN 12 31,502,628 (GRCm39) missense probably damaging 1.00
PIT4486001:Slc26a3 UTSW 12 31,520,949 (GRCm39) missense probably benign 0.01
R0422:Slc26a3 UTSW 12 31,515,848 (GRCm39) missense possibly damaging 0.90
R0544:Slc26a3 UTSW 12 31,497,739 (GRCm39) missense probably benign
R0781:Slc26a3 UTSW 12 31,515,812 (GRCm39) missense possibly damaging 0.90
R1561:Slc26a3 UTSW 12 31,516,451 (GRCm39) missense probably benign 0.18
R1860:Slc26a3 UTSW 12 31,515,845 (GRCm39) missense probably benign
R1954:Slc26a3 UTSW 12 31,500,815 (GRCm39) missense probably damaging 0.98
R1967:Slc26a3 UTSW 12 31,515,777 (GRCm39) missense probably damaging 0.99
R2240:Slc26a3 UTSW 12 31,507,071 (GRCm39) missense probably damaging 1.00
R2508:Slc26a3 UTSW 12 31,520,902 (GRCm39) missense probably damaging 0.99
R3894:Slc26a3 UTSW 12 31,514,719 (GRCm39) missense probably damaging 1.00
R3914:Slc26a3 UTSW 12 31,503,905 (GRCm39) missense probably benign 0.00
R3978:Slc26a3 UTSW 12 31,515,859 (GRCm39) splice site probably null
R4701:Slc26a3 UTSW 12 31,497,773 (GRCm39) missense probably damaging 1.00
R5024:Slc26a3 UTSW 12 31,503,907 (GRCm39) missense probably benign
R5058:Slc26a3 UTSW 12 31,520,964 (GRCm39) missense possibly damaging 0.66
R5168:Slc26a3 UTSW 12 31,518,553 (GRCm39) missense possibly damaging 0.81
R5361:Slc26a3 UTSW 12 31,500,980 (GRCm39) critical splice donor site probably null
R5715:Slc26a3 UTSW 12 31,498,842 (GRCm39) critical splice donor site probably null
R5951:Slc26a3 UTSW 12 31,502,714 (GRCm39) intron probably benign
R6662:Slc26a3 UTSW 12 31,507,345 (GRCm39) nonsense probably null
R6895:Slc26a3 UTSW 12 31,513,523 (GRCm39) missense probably damaging 0.96
R7069:Slc26a3 UTSW 12 31,500,934 (GRCm39) missense probably damaging 0.96
R7484:Slc26a3 UTSW 12 31,497,787 (GRCm39) missense probably benign 0.22
R7744:Slc26a3 UTSW 12 31,513,464 (GRCm39) critical splice acceptor site probably null
R8192:Slc26a3 UTSW 12 31,518,541 (GRCm39) missense probably benign 0.05
R8327:Slc26a3 UTSW 12 31,516,430 (GRCm39) missense possibly damaging 0.81
R8356:Slc26a3 UTSW 12 31,516,505 (GRCm39) missense probably benign 0.06
R8371:Slc26a3 UTSW 12 31,502,541 (GRCm39) missense probably damaging 1.00
R8550:Slc26a3 UTSW 12 31,511,739 (GRCm39) missense probably damaging 1.00
R9057:Slc26a3 UTSW 12 31,520,958 (GRCm39) missense probably benign 0.00
R9221:Slc26a3 UTSW 12 31,513,470 (GRCm39) missense possibly damaging 0.95
R9484:Slc26a3 UTSW 12 31,511,785 (GRCm39) missense probably damaging 0.98
R9746:Slc26a3 UTSW 12 31,499,145 (GRCm39) missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- ATTCAGCCCAGACGGTATCC -3'
(R):5'- CCCTGCAAATCCTTTGAATGC -3'

Sequencing Primer
(F):5'- AGACGGTATCCATTCATTTATTTGCC -3'
(R):5'- GTGAATATGTTGCTCACTCCCAAGG -3'
Posted On 2015-10-21