Incidental Mutation 'R4713:Chdh'
ID 353397
Institutional Source Beutler Lab
Gene Symbol Chdh
Ensembl Gene ENSMUSG00000015970
Gene Name choline dehydrogenase
Synonyms D630034H06Rik
MMRRC Submission 041601-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R4713 (G1)
Quality Score 225
Status Not validated
Chromosome 14
Chromosomal Location 30009023-30040527 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 30036841 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 581 (D581G)
Ref Sequence ENSEMBL: ENSMUSP00000112916 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000067620] [ENSMUST00000112249] [ENSMUST00000112250] [ENSMUST00000118917] [ENSMUST00000224395] [ENSMUST00000224785]
AlphaFold Q8BJ64
Predicted Effect probably benign
Transcript: ENSMUST00000067620
AA Change: D581G

PolyPhen 2 Score 0.280 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000065542
Gene: ENSMUSG00000015970
AA Change: D581G

DomainStartEndE-ValueType
Pfam:GMC_oxred_N 43 341 2.4e-98 PFAM
Pfam:Lycopene_cycl 45 110 8.4e-8 PFAM
Pfam:GMC_oxred_C 431 569 2.5e-43 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000112249
SMART Domains Protein: ENSMUSP00000107868
Gene: ENSMUSG00000015968

DomainStartEndE-ValueType
low complexity region 1 10 N/A INTRINSIC
low complexity region 54 67 N/A INTRINSIC
Pfam:Ion_trans 163 405 4.8e-59 PFAM
PDB:4DEY|B 406 502 3e-38 PDB
low complexity region 503 517 N/A INTRINSIC
Pfam:Ion_trans 557 751 5.5e-46 PFAM
low complexity region 766 781 N/A INTRINSIC
low complexity region 819 840 N/A INTRINSIC
Pfam:Ion_trans 921 1151 7.2e-51 PFAM
Pfam:Ion_trans 1239 1448 3.6e-67 PFAM
Pfam:PKD_channel 1285 1455 1.9e-9 PFAM
Blast:EFh 1469 1497 2e-9 BLAST
Ca_chan_IQ 1583 1617 5.05e-16 SMART
low complexity region 1649 1661 N/A INTRINSIC
low complexity region 1722 1728 N/A INTRINSIC
low complexity region 1830 1840 N/A INTRINSIC
low complexity region 1885 1905 N/A INTRINSIC
low complexity region 1921 1936 N/A INTRINSIC
low complexity region 2122 2133 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000112250
SMART Domains Protein: ENSMUSP00000107869
Gene: ENSMUSG00000015968

DomainStartEndE-ValueType
low complexity region 76 89 N/A INTRINSIC
Pfam:Ion_trans 147 439 5.6e-72 PFAM
low complexity region 473 482 N/A INTRINSIC
low complexity region 525 539 N/A INTRINSIC
Pfam:Ion_trans 544 784 2e-56 PFAM
low complexity region 788 803 N/A INTRINSIC
low complexity region 841 862 N/A INTRINSIC
Pfam:Ion_trans 907 1185 2.6e-63 PFAM
Pfam:Ion_trans 1226 1482 1.7e-70 PFAM
Pfam:PKD_channel 1306 1477 1.2e-9 PFAM
Pfam:GPHH 1484 1553 2.3e-38 PFAM
Ca_chan_IQ 1605 1639 5.05e-16 SMART
Pfam:CAC1F_C 1649 2165 1.1e-68 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000118917
AA Change: D581G

PolyPhen 2 Score 0.280 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000112916
Gene: ENSMUSG00000015970
AA Change: D581G

DomainStartEndE-ValueType
Pfam:GMC_oxred_N 43 341 2.4e-98 PFAM
Pfam:Lycopene_cycl 44 109 1.9e-8 PFAM
Pfam:GMC_oxred_C 431 569 5.9e-42 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223573
Predicted Effect probably benign
Transcript: ENSMUST00000224395
Predicted Effect probably benign
Transcript: ENSMUST00000224785
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225717
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.7%
  • 20x: 94.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a choline dehydrogenase that localizes to the mitochondrion. Variations in this gene can affect susceptibility to choline deficiency. A few transcript variants have been found for this gene, but the full-length nature of only one has been characterized to date. [provided by RefSeq, Dec 2010]
PHENOTYPE: Homozygous male mutants show reduced fertility due to reduced sperm motility caused by abnormal mitochondrial function and structures. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrb3 G T 1: 25,547,532 T360K probably damaging Het
AW551984 T C 9: 39,597,153 K356E probably benign Het
Bpifb2 T A 2: 153,881,193 V123E probably damaging Het
Cacna1a T G 8: 84,549,514 F532V probably damaging Het
Cct8 C A 16: 87,487,688 E204* probably null Het
Cd163 T A 6: 124,317,618 probably null Het
Cep152 C A 2: 125,587,948 A685S possibly damaging Het
Cnpy3 A C 17: 46,747,465 Y77* probably null Het
Col5a3 T C 9: 20,793,574 E762G unknown Het
Creb3 A G 4: 43,563,247 T115A probably benign Het
Dlat G T 9: 50,644,481 A412E probably benign Het
Dnah2 T C 11: 69,476,688 N1789S probably damaging Het
Dzank1 C T 2: 144,491,804 E370K probably benign Het
Eif3m A T 2: 105,006,839 probably null Het
Gimap8 A T 6: 48,658,986 M562L probably benign Het
Gm15448 G T 7: 3,822,681 Y396* probably null Het
Gprc6a T A 10: 51,631,457 probably benign Het
Gsr T G 8: 33,680,319 probably null Het
Gstcd A G 3: 132,983,099 V630A probably damaging Het
Hip1r T C 5: 123,989,980 I116T probably benign Het
Hivep3 A G 4: 120,131,803 E1817G probably damaging Het
Inpp5f A C 7: 128,663,725 T135P probably damaging Het
Ism2 A G 12: 87,285,027 silent Het
Itga11 A G 9: 62,765,788 D784G probably damaging Het
Itpr2 A G 6: 146,373,173 F837S probably damaging Het
Itpr2 T C 6: 146,396,958 E10G probably damaging Het
Knl1 A T 2: 119,069,137 K440* probably null Het
Lonp2 T C 8: 86,713,315 S648P probably damaging Het
Lrba T C 3: 86,359,868 S1622P probably benign Het
Lrp2 G T 2: 69,487,966 A2047D probably damaging Het
Mcm3 G A 1: 20,803,577 T773I probably benign Het
Mfsd7a T C 5: 108,442,079 T486A probably damaging Het
Mki67 A G 7: 135,695,469 V2612A probably benign Het
Mnx1 C A 5: 29,478,131 G49W probably damaging Het
Muc5b T A 7: 141,849,079 Y673* probably null Het
Myo15 A G 11: 60,479,930 H1172R probably benign Het
Myo1g T C 11: 6,516,080 K363R probably null Het
Ncoa4 T A 14: 32,176,641 C473S probably benign Het
Nefh T C 11: 4,939,656 T988A unknown Het
Nwd2 T A 5: 63,804,460 D462E probably benign Het
Olfr332 T C 11: 58,490,087 T223A probably benign Het
Plec T C 15: 76,181,067 E1466G unknown Het
Prl3d2 G T 13: 27,122,396 M35I probably benign Het
Reln T A 5: 22,152,463 I202F probably benign Het
Rhot1 T A 11: 80,225,602 D78E probably benign Het
Rsph3b T C 17: 6,905,129 probably null Het
Scn10a C T 9: 119,609,651 M1717I probably damaging Het
Sema6a T A 18: 47,249,296 H728L possibly damaging Het
Slc26a3 G T 12: 31,457,080 A345S possibly damaging Het
Slc35d2 A G 13: 64,099,283 V261A possibly damaging Het
Ssmem1 A G 6: 30,519,514 D66G probably damaging Het
Sult2a8 A T 7: 14,425,477 N72K probably benign Het
Tbx10 T C 19: 3,996,921 L108P probably damaging Het
Tex14 T C 11: 87,536,865 S48P probably damaging Het
Tmie A G 9: 110,867,528 L95P probably damaging Het
Tom1l2 C G 11: 60,270,433 R84P probably damaging Het
Trpm3 T A 19: 22,889,435 D543E possibly damaging Het
Vipr2 A C 12: 116,080,131 R49S probably benign Het
Vps8 A T 16: 21,442,439 S110C probably damaging Het
Zfp791 T A 8: 85,110,968 N89I probably damaging Het
Other mutations in Chdh
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01019:Chdh APN 14 30031332 missense probably benign 0.15
IGL01309:Chdh APN 14 30035804 unclassified probably benign
IGL01515:Chdh APN 14 30036886 missense probably damaging 1.00
IGL01828:Chdh APN 14 30036608 missense probably damaging 0.96
IGL01953:Chdh APN 14 30035347 missense probably benign 0.24
IGL01989:Chdh APN 14 30031731 missense possibly damaging 0.71
IGL02325:Chdh APN 14 30032825 missense probably benign 0.01
IGL02620:Chdh APN 14 30031139 missense probably damaging 0.99
IGL03180:Chdh APN 14 30034602 splice site probably null
R0024:Chdh UTSW 14 30031596 missense possibly damaging 0.81
R0455:Chdh UTSW 14 30034646 missense probably damaging 1.00
R0486:Chdh UTSW 14 30032858 missense possibly damaging 0.83
R0668:Chdh UTSW 14 30035880 missense probably damaging 1.00
R0684:Chdh UTSW 14 30031613 missense probably damaging 1.00
R0971:Chdh UTSW 14 30033663 missense probably damaging 1.00
R1291:Chdh UTSW 14 30031562 nonsense probably null
R1381:Chdh UTSW 14 30036834 missense probably damaging 1.00
R1386:Chdh UTSW 14 30031434 missense probably damaging 1.00
R1412:Chdh UTSW 14 30034723 missense probably benign 0.01
R1912:Chdh UTSW 14 30032788 missense probably benign 0.00
R2198:Chdh UTSW 14 30031532 missense possibly damaging 0.91
R4077:Chdh UTSW 14 30035340 missense probably damaging 0.99
R4412:Chdh UTSW 14 30031715 missense probably damaging 1.00
R4865:Chdh UTSW 14 30033724 missense probably benign 0.00
R4940:Chdh UTSW 14 30032852 missense possibly damaging 0.82
R5207:Chdh UTSW 14 30031361 missense probably damaging 1.00
R5582:Chdh UTSW 14 30036859 missense probably damaging 1.00
R5710:Chdh UTSW 14 30034627 missense probably damaging 1.00
R5954:Chdh UTSW 14 30031181 missense possibly damaging 0.87
R6245:Chdh UTSW 14 30035305 missense probably damaging 0.99
R7032:Chdh UTSW 14 30036852 missense possibly damaging 0.89
R7868:Chdh UTSW 14 30031331 missense probably benign
R9083:Chdh UTSW 14 30031746 missense probably damaging 1.00
R9363:Chdh UTSW 14 30031353 missense probably damaging 1.00
R9427:Chdh UTSW 14 30036849 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- TCGTGCACCTGTAAGATGGG -3'
(R):5'- AGAAACCATGAAAGTCTGAGCC -3'

Sequencing Primer
(F):5'- TAAGATGGGCCGGTCCTCTG -3'
(R):5'- CCATGAAAGTCTGAGCCAAGAGTC -3'
Posted On 2015-10-21