Incidental Mutation 'R4713:Ncoa4'
ID353398
Institutional Source Beutler Lab
Gene Symbol Ncoa4
Ensembl Gene ENSMUSG00000056234
Gene Namenuclear receptor coactivator 4
Synonyms
MMRRC Submission 041601-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.070) question?
Stock #R4713 (G1)
Quality Score111
Status Not validated
Chromosome14
Chromosomal Location32159865-32179855 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 32176641 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Serine at position 473 (C473S)
Ref Sequence ENSEMBL: ENSMUSP00000126071 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000013845] [ENSMUST00000111994] [ENSMUST00000163336] [ENSMUST00000163379] [ENSMUST00000164341] [ENSMUST00000168034] [ENSMUST00000168114] [ENSMUST00000168334] [ENSMUST00000168385] [ENSMUST00000169722] [ENSMUST00000170331] [ENSMUST00000226479] [ENSMUST00000226683]
Predicted Effect probably benign
Transcript: ENSMUST00000013845
SMART Domains Protein: ENSMUSP00000013845
Gene: ENSMUSG00000013701

DomainStartEndE-ValueType
low complexity region 3 25 N/A INTRINSIC
Pfam:Tim17 76 196 6.6e-19 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000111994
AA Change: C473S

PolyPhen 2 Score 0.049 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000107625
Gene: ENSMUSG00000056234
AA Change: C473S

DomainStartEndE-ValueType
Pfam:ARA70 37 168 5e-44 PFAM
Pfam:ARA70 197 338 5.1e-45 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000163336
AA Change: C473S

PolyPhen 2 Score 0.049 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000126071
Gene: ENSMUSG00000056234
AA Change: C473S

DomainStartEndE-ValueType
Pfam:ARA70 33 169 2.4e-28 PFAM
Pfam:ARA70 199 334 4.7e-51 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000163379
SMART Domains Protein: ENSMUSP00000129688
Gene: ENSMUSG00000013701

DomainStartEndE-ValueType
low complexity region 3 25 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000164341
SMART Domains Protein: ENSMUSP00000126780
Gene: ENSMUSG00000056234

DomainStartEndE-ValueType
Pfam:ARA70 37 99 3.2e-20 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000168034
SMART Domains Protein: ENSMUSP00000129422
Gene: ENSMUSG00000056234

DomainStartEndE-ValueType
Pfam:ARA70 45 131 1.3e-27 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000168114
SMART Domains Protein: ENSMUSP00000131253
Gene: ENSMUSG00000056234

DomainStartEndE-ValueType
Pfam:ARA70 64 105 2.2e-12 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000168139
Predicted Effect probably benign
Transcript: ENSMUST00000168334
SMART Domains Protein: ENSMUSP00000128739
Gene: ENSMUSG00000056234

DomainStartEndE-ValueType
Pfam:ARA70 37 96 1.1e-17 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000168385
SMART Domains Protein: ENSMUSP00000126222
Gene: ENSMUSG00000056234

DomainStartEndE-ValueType
Pfam:ARA70 1 73 8.2e-24 PFAM
Pfam:ARA70 102 205 2.9e-33 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000169722
SMART Domains Protein: ENSMUSP00000129917
Gene: ENSMUSG00000056234

DomainStartEndE-ValueType
Pfam:ARA70 37 168 6.5e-45 PFAM
Pfam:ARA70 196 337 6.3e-46 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000170331
SMART Domains Protein: ENSMUSP00000126977
Gene: ENSMUSG00000013701

DomainStartEndE-ValueType
low complexity region 3 25 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000226479
Predicted Effect noncoding transcript
Transcript: ENSMUST00000228779
Predicted Effect noncoding transcript
Transcript: ENSMUST00000227112
Predicted Effect probably benign
Transcript: ENSMUST00000226683
Predicted Effect noncoding transcript
Transcript: ENSMUST00000227498
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.7%
  • 20x: 94.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an androgen receptor coactivator. The encoded protein interacts with the androgen receptor in a ligand-dependent manner to enhance its transcriptional activity. Chromosomal translocations between this gene and the ret tyrosine kinase gene, also located on chromosome 10, have been associated with papillary thyroid carcinoma. Alternatively spliced transcript variants have been described. Pseudogenes are present on chromosomes 4, 5, 10, and 14. [provided by RefSeq, Feb 2009]
PHENOTYPE: Mouse embryonic fibroblasts isolated from homozygous null mice exhibit abnormal DNA replication, decreased fibroblast proliferation, and early cellular replicative senescence. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrb3 G T 1: 25,547,532 T360K probably damaging Het
AW551984 T C 9: 39,597,153 K356E probably benign Het
Bpifb2 T A 2: 153,881,193 V123E probably damaging Het
Cacna1a T G 8: 84,549,514 F532V probably damaging Het
Cct8 C A 16: 87,487,688 E204* probably null Het
Cd163 T A 6: 124,317,618 probably null Het
Cep152 C A 2: 125,587,948 A685S possibly damaging Het
Chdh A G 14: 30,036,841 D581G probably benign Het
Cnpy3 A C 17: 46,747,465 Y77* probably null Het
Col5a3 T C 9: 20,793,574 E762G unknown Het
Creb3 A G 4: 43,563,247 T115A probably benign Het
Dlat G T 9: 50,644,481 A412E probably benign Het
Dnah2 T C 11: 69,476,688 N1789S probably damaging Het
Dzank1 C T 2: 144,491,804 E370K probably benign Het
Eif3m A T 2: 105,006,839 probably null Het
Gimap8 A T 6: 48,658,986 M562L probably benign Het
Gm15448 G T 7: 3,822,681 Y396* probably null Het
Gprc6a T A 10: 51,631,457 probably benign Het
Gsr T G 8: 33,680,319 probably null Het
Gstcd A G 3: 132,983,099 V630A probably damaging Het
Hip1r T C 5: 123,989,980 I116T probably benign Het
Hivep3 A G 4: 120,131,803 E1817G probably damaging Het
Inpp5f A C 7: 128,663,725 T135P probably damaging Het
Ism2 A G 12: 87,285,027 silent Het
Itga11 A G 9: 62,765,788 D784G probably damaging Het
Itpr2 A G 6: 146,373,173 F837S probably damaging Het
Itpr2 T C 6: 146,396,958 E10G probably damaging Het
Knl1 A T 2: 119,069,137 K440* probably null Het
Lonp2 T C 8: 86,713,315 S648P probably damaging Het
Lrba T C 3: 86,359,868 S1622P probably benign Het
Lrp2 G T 2: 69,487,966 A2047D probably damaging Het
Mcm3 G A 1: 20,803,577 T773I probably benign Het
Mfsd7a T C 5: 108,442,079 T486A probably damaging Het
Mki67 A G 7: 135,695,469 V2612A probably benign Het
Mnx1 C A 5: 29,478,131 G49W probably damaging Het
Muc5b T A 7: 141,849,079 Y673* probably null Het
Myo15 A G 11: 60,479,930 H1172R probably benign Het
Myo1g T C 11: 6,516,080 K363R probably null Het
Nefh T C 11: 4,939,656 T988A unknown Het
Nwd2 T A 5: 63,804,460 D462E probably benign Het
Olfr332 T C 11: 58,490,087 T223A probably benign Het
Plec T C 15: 76,181,067 E1466G unknown Het
Prl3d2 G T 13: 27,122,396 M35I probably benign Het
Reln T A 5: 22,152,463 I202F probably benign Het
Rhot1 T A 11: 80,225,602 D78E probably benign Het
Rsph3b T C 17: 6,905,129 probably null Het
Scn10a C T 9: 119,609,651 M1717I probably damaging Het
Sema6a T A 18: 47,249,296 H728L possibly damaging Het
Slc26a3 G T 12: 31,457,080 A345S possibly damaging Het
Slc35d2 A G 13: 64,099,283 V261A possibly damaging Het
Ssmem1 A G 6: 30,519,514 D66G probably damaging Het
Sult2a8 A T 7: 14,425,477 N72K probably benign Het
Tbx10 T C 19: 3,996,921 L108P probably damaging Het
Tex14 T C 11: 87,536,865 S48P probably damaging Het
Tmie A G 9: 110,867,528 L95P probably damaging Het
Tom1l2 C G 11: 60,270,433 R84P probably damaging Het
Trpm3 T A 19: 22,889,435 D543E possibly damaging Het
Vipr2 A C 12: 116,080,131 R49S probably benign Het
Vps8 A T 16: 21,442,439 S110C probably damaging Het
Zfp791 T A 8: 85,110,968 N89I probably damaging Het
Other mutations in Ncoa4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01583:Ncoa4 APN 14 32172927 missense probably benign 0.19
IGL02963:Ncoa4 APN 14 32176509 missense probably damaging 1.00
IGL03062:Ncoa4 APN 14 32173420 missense possibly damaging 0.89
R0613:Ncoa4 UTSW 14 32176552 missense probably damaging 1.00
R1353:Ncoa4 UTSW 14 32170858 nonsense probably null
R1395:Ncoa4 UTSW 14 32172841 splice site probably null
R1430:Ncoa4 UTSW 14 32176722 missense probably benign 0.00
R1509:Ncoa4 UTSW 14 32173434 missense probably damaging 1.00
R1541:Ncoa4 UTSW 14 32176888 missense probably damaging 1.00
R2292:Ncoa4 UTSW 14 32173456 missense probably damaging 0.98
R4610:Ncoa4 UTSW 14 32176725 missense probably benign 0.01
R5750:Ncoa4 UTSW 14 32177307 nonsense probably null
R5889:Ncoa4 UTSW 14 32166659 unclassified probably benign
R5928:Ncoa4 UTSW 14 32166721 critical splice donor site probably null
R6738:Ncoa4 UTSW 14 32170793 missense probably benign
R7065:Ncoa4 UTSW 14 32172900 nonsense probably null
R7165:Ncoa4 UTSW 14 32175983 missense probably damaging 0.97
R7257:Ncoa4 UTSW 14 32177369 missense probably damaging 1.00
R8373:Ncoa4 UTSW 14 32176936 missense probably damaging 1.00
R8919:Ncoa4 UTSW 14 32172891 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTGCCCAGAACCATCAGGAC -3'
(R):5'- AAGCATCTCTTTGCCAGCTC -3'

Sequencing Primer
(F):5'- AGAACCATCAGGACACATGG -3'
(R):5'- CTCTCCTCTGTATTAGGCACG -3'
Posted On2015-10-21