Incidental Mutation 'R4713:Cct8'
ID 353401
Institutional Source Beutler Lab
Gene Symbol Cct8
Ensembl Gene ENSMUSG00000025613
Gene Name chaperonin containing Tcp1, subunit 8 (theta)
Synonyms Cctq, Tcpq
MMRRC Submission 041601-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.967) question?
Stock # R4713 (G1)
Quality Score 225
Status Not validated
Chromosome 16
Chromosomal Location 87483326-87495873 bp(-) (GRCm38)
Type of Mutation nonsense
DNA Base Change (assembly) C to A at 87487688 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Stop codon at position 204 (E204*)
Ref Sequence ENSEMBL: ENSMUSP00000135651 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026704] [ENSMUST00000026710] [ENSMUST00000119504] [ENSMUST00000144759] [ENSMUST00000175977] [ENSMUST00000176041] [ENSMUST00000176750] [ENSMUST00000177376]
AlphaFold P42932
Predicted Effect probably null
Transcript: ENSMUST00000026704
AA Change: E263*
SMART Domains Protein: ENSMUSP00000026704
Gene: ENSMUSG00000025613
AA Change: E263*

DomainStartEndE-ValueType
Pfam:Cpn60_TCP1 39 529 6.7e-156 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000026710
SMART Domains Protein: ENSMUSP00000026710
Gene: ENSMUSG00000025616

DomainStartEndE-ValueType
Pfam:zf-UBP 48 127 2.5e-23 PFAM
coiled coil region 149 182 N/A INTRINSIC
Pfam:UCH 194 821 2e-54 PFAM
Pfam:UCH_1 195 800 3.8e-15 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000119504
SMART Domains Protein: ENSMUSP00000114058
Gene: ENSMUSG00000025616

DomainStartEndE-ValueType
Pfam:zf-UBP 48 127 6.9e-24 PFAM
coiled coil region 149 181 N/A INTRINSIC
Pfam:UCH 193 732 1.2e-36 PFAM
Pfam:UCH_1 194 737 2.5e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000144759
SMART Domains Protein: ENSMUSP00000116323
Gene: ENSMUSG00000025616

DomainStartEndE-ValueType
Pfam:zf-UBP 48 127 2e-24 PFAM
coiled coil region 149 181 N/A INTRINSIC
Pfam:UCH 193 330 2.4e-23 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149656
Predicted Effect probably null
Transcript: ENSMUST00000175750
AA Change: E21*
SMART Domains Protein: ENSMUSP00000134920
Gene: ENSMUSG00000025613
AA Change: E21*

DomainStartEndE-ValueType
Pfam:Cpn60_TCP1 1 238 1.2e-69 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000175977
AA Change: E204*
SMART Domains Protein: ENSMUSP00000135651
Gene: ENSMUSG00000025613
AA Change: E204*

DomainStartEndE-ValueType
Pfam:Cpn60_TCP1 39 132 4.5e-32 PFAM
Pfam:Cpn60_TCP1 120 470 1.9e-94 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000176041
SMART Domains Protein: ENSMUSP00000135377
Gene: ENSMUSG00000025613

DomainStartEndE-ValueType
Pfam:Cpn60_TCP1 1 158 3.3e-41 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176241
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176589
Predicted Effect probably benign
Transcript: ENSMUST00000176750
SMART Domains Protein: ENSMUSP00000135830
Gene: ENSMUSG00000025613

DomainStartEndE-ValueType
Pfam:Cpn60_TCP1 1 132 1.7e-35 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000177275
Predicted Effect noncoding transcript
Transcript: ENSMUST00000177301
Predicted Effect probably benign
Transcript: ENSMUST00000177376
SMART Domains Protein: ENSMUSP00000135498
Gene: ENSMUSG00000025613

DomainStartEndE-ValueType
PDB:4B2T|Q 1 51 1e-29 PDB
SCOP:d1oela1 26 51 8e-4 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000177485
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.7%
  • 20x: 94.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the theta subunit of the CCT chaperonin, which is abundant in the eukaryotic cytosol and may be involved in the transport and assembly of newly synthesized proteins. Alternative splicing results in multiple transcript variants of this gene. A pseudogene related to this gene is located on chromosome 1. [provided by RefSeq, Sep 2013]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrb3 G T 1: 25,547,532 T360K probably damaging Het
AW551984 T C 9: 39,597,153 K356E probably benign Het
Bpifb2 T A 2: 153,881,193 V123E probably damaging Het
Cacna1a T G 8: 84,549,514 F532V probably damaging Het
Cd163 T A 6: 124,317,618 probably null Het
Cep152 C A 2: 125,587,948 A685S possibly damaging Het
Chdh A G 14: 30,036,841 D581G probably benign Het
Cnpy3 A C 17: 46,747,465 Y77* probably null Het
Col5a3 T C 9: 20,793,574 E762G unknown Het
Creb3 A G 4: 43,563,247 T115A probably benign Het
Dlat G T 9: 50,644,481 A412E probably benign Het
Dnah2 T C 11: 69,476,688 N1789S probably damaging Het
Dzank1 C T 2: 144,491,804 E370K probably benign Het
Eif3m A T 2: 105,006,839 probably null Het
Gimap8 A T 6: 48,658,986 M562L probably benign Het
Gm15448 G T 7: 3,822,681 Y396* probably null Het
Gprc6a T A 10: 51,631,457 probably benign Het
Gsr T G 8: 33,680,319 probably null Het
Gstcd A G 3: 132,983,099 V630A probably damaging Het
Hip1r T C 5: 123,989,980 I116T probably benign Het
Hivep3 A G 4: 120,131,803 E1817G probably damaging Het
Inpp5f A C 7: 128,663,725 T135P probably damaging Het
Ism2 A G 12: 87,285,027 silent Het
Itga11 A G 9: 62,765,788 D784G probably damaging Het
Itpr2 A G 6: 146,373,173 F837S probably damaging Het
Itpr2 T C 6: 146,396,958 E10G probably damaging Het
Knl1 A T 2: 119,069,137 K440* probably null Het
Lonp2 T C 8: 86,713,315 S648P probably damaging Het
Lrba T C 3: 86,359,868 S1622P probably benign Het
Lrp2 G T 2: 69,487,966 A2047D probably damaging Het
Mcm3 G A 1: 20,803,577 T773I probably benign Het
Mfsd7a T C 5: 108,442,079 T486A probably damaging Het
Mki67 A G 7: 135,695,469 V2612A probably benign Het
Mnx1 C A 5: 29,478,131 G49W probably damaging Het
Muc5b T A 7: 141,849,079 Y673* probably null Het
Myo15 A G 11: 60,479,930 H1172R probably benign Het
Myo1g T C 11: 6,516,080 K363R probably null Het
Ncoa4 T A 14: 32,176,641 C473S probably benign Het
Nefh T C 11: 4,939,656 T988A unknown Het
Nwd2 T A 5: 63,804,460 D462E probably benign Het
Olfr332 T C 11: 58,490,087 T223A probably benign Het
Plec T C 15: 76,181,067 E1466G unknown Het
Prl3d2 G T 13: 27,122,396 M35I probably benign Het
Reln T A 5: 22,152,463 I202F probably benign Het
Rhot1 T A 11: 80,225,602 D78E probably benign Het
Rsph3b T C 17: 6,905,129 probably null Het
Scn10a C T 9: 119,609,651 M1717I probably damaging Het
Sema6a T A 18: 47,249,296 H728L possibly damaging Het
Slc26a3 G T 12: 31,457,080 A345S possibly damaging Het
Slc35d2 A G 13: 64,099,283 V261A possibly damaging Het
Ssmem1 A G 6: 30,519,514 D66G probably damaging Het
Sult2a8 A T 7: 14,425,477 N72K probably benign Het
Tbx10 T C 19: 3,996,921 L108P probably damaging Het
Tex14 T C 11: 87,536,865 S48P probably damaging Het
Tmie A G 9: 110,867,528 L95P probably damaging Het
Tom1l2 C G 11: 60,270,433 R84P probably damaging Het
Trpm3 T A 19: 22,889,435 D543E possibly damaging Het
Vipr2 A C 12: 116,080,131 R49S probably benign Het
Vps8 A T 16: 21,442,439 S110C probably damaging Het
Zfp791 T A 8: 85,110,968 N89I probably damaging Het
Other mutations in Cct8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02054:Cct8 APN 16 87490476 splice site probably benign
IGL02975:Cct8 APN 16 87486230 splice site probably benign
IGL03015:Cct8 APN 16 87486665 splice site probably benign
IGL03191:Cct8 APN 16 87486310 missense probably damaging 1.00
PIT4151001:Cct8 UTSW 16 87487657 missense probably damaging 1.00
R0479:Cct8 UTSW 16 87487706 missense probably damaging 1.00
R0972:Cct8 UTSW 16 87486620 missense possibly damaging 0.94
R1368:Cct8 UTSW 16 87491312 missense probably damaging 0.99
R1544:Cct8 UTSW 16 87491454 splice site probably benign
R1548:Cct8 UTSW 16 87485584 missense probably damaging 0.99
R1823:Cct8 UTSW 16 87490554 nonsense probably null
R2303:Cct8 UTSW 16 87490332 splice site probably null
R3076:Cct8 UTSW 16 87488877 missense possibly damaging 0.84
R3078:Cct8 UTSW 16 87488877 missense possibly damaging 0.84
R4094:Cct8 UTSW 16 87487628 missense possibly damaging 0.94
R5031:Cct8 UTSW 16 87487538 missense probably damaging 0.99
R5687:Cct8 UTSW 16 87488821 missense probably benign 0.00
R6325:Cct8 UTSW 16 87495727 critical splice donor site probably null
R6391:Cct8 UTSW 16 87487678 missense probably benign 0.00
R6395:Cct8 UTSW 16 87486476 nonsense probably null
R7252:Cct8 UTSW 16 87484919 missense probably benign 0.01
R7570:Cct8 UTSW 16 87491322 missense probably benign 0.18
R8397:Cct8 UTSW 16 87493763 missense possibly damaging 0.95
R8766:Cct8 UTSW 16 87488868 missense probably damaging 0.97
R9309:Cct8 UTSW 16 87485704 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- CAAGAATGTAGCTCTTACCTCACC -3'
(R):5'- GACGTGAGAGTGAAGGTCTTC -3'

Sequencing Primer
(F):5'- ATGTAGCTCTTACCTCACCAACATG -3'
(R):5'- CATGAGGAGCTTTTAACAAGTACGTG -3'
Posted On 2015-10-21