Incidental Mutation 'R0276:Spta1'
ID 35342
Institutional Source Beutler Lab
Gene Symbol Spta1
Ensembl Gene ENSMUSG00000026532
Gene Name spectrin alpha, erythrocytic 1
Synonyms erythroid, Spna-1, ihj, Spna1
MMRRC Submission 038498-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.872) question?
Stock # R0276 (G1)
Quality Score 225
Status Validated
Chromosome 1
Chromosomal Location 174000342-174076016 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 174045460 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Histidine to Glutamine at position 1539 (H1539Q)
Ref Sequence ENSEMBL: ENSMUSP00000027817 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027817]
AlphaFold P08032
Predicted Effect probably damaging
Transcript: ENSMUST00000027817
AA Change: H1539Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000027817
Gene: ENSMUSG00000026532
AA Change: H1539Q

DomainStartEndE-ValueType
SPEC 55 153 3.62e-11 SMART
SPEC 159 259 1.84e-26 SMART
SPEC 265 365 1.56e-24 SMART
SPEC 371 471 8.35e-25 SMART
SPEC 477 577 1.19e-29 SMART
SPEC 583 682 2.43e-26 SMART
SPEC 688 788 1.3e-26 SMART
SPEC 794 894 1.66e-28 SMART
SPEC 900 1077 5.03e-19 SMART
SH3 978 1033 2.98e-15 SMART
SPEC 1083 1178 2.57e-16 SMART
SPEC 1184 1284 1.15e-27 SMART
SPEC 1290 1390 7.05e-23 SMART
SPEC 1396 1495 6.04e-22 SMART
SPEC 1501 1602 1.15e-27 SMART
SPEC 1608 1708 5.46e-29 SMART
SPEC 1714 1814 1.08e-32 SMART
SPEC 1820 1921 2.17e-23 SMART
SPEC 1927 2028 2.19e-19 SMART
SPEC 2042 2142 3.87e-11 SMART
SPEC 2156 2253 9.77e-8 SMART
low complexity region 2307 2318 N/A INTRINSIC
efhand_Ca_insen 2346 2414 2.37e-27 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156092
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 98.7%
  • 3x: 97.8%
  • 10x: 96.2%
  • 20x: 93.8%
Validation Efficiency 98% (101/103)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Spectrin is an actin crosslinking and molecular scaffold protein that links the plasma membrane to the actin cytoskeleton, and functions in the determination of cell shape, arrangement of transmembrane proteins, and organization of organelles. It is a tetramer made up of alpha-beta dimers linked in a head-to-head arrangement. This gene is one member of a family of alpha-spectrin genes. The encoded protein is primarily composed of 22 spectrin repeats which are involved in dimer formation. It forms weaker tetramer interactions than non-erythrocytic alpha spectrin, which may increase the plasma membrane elasticity and deformability of red blood cells. Mutations in this gene result in a variety of hereditary red blood cell disorders, including elliptocytosis type 2, pyropoikilocytosis, and spherocytic hemolytic anemia. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for spontaneous mutations exhibit microcytic, hypochromic, hemolytic anemia, jaundice, and high neonatal mortality. Heterozygotes of some alleles may exhibit a mild spherocytic transition. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 100 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts13 A G 2: 26,865,772 (GRCm39) N109S possibly damaging Het
Adcy10 T A 1: 165,400,160 (GRCm39) M1523K possibly damaging Het
Agtpbp1 C T 13: 59,609,845 (GRCm39) S1095N possibly damaging Het
Ang2 C T 14: 51,432,975 (GRCm39) V136I probably damaging Het
Arhgap10 A T 8: 78,140,210 (GRCm39) M250K probably benign Het
Arhgap33 A T 7: 30,222,669 (GRCm39) W1088R probably benign Het
Arhgef15 T C 11: 68,844,298 (GRCm39) probably benign Het
Aspm T C 1: 139,406,209 (GRCm39) S1699P possibly damaging Het
Atp12a C A 14: 56,625,151 (GRCm39) D1014E probably damaging Het
Atp1a4 T A 1: 172,085,468 (GRCm39) K45M probably damaging Het
Atp8a1 A T 5: 67,944,016 (GRCm39) probably benign Het
Baiap3 A C 17: 25,462,661 (GRCm39) F1099C probably damaging Het
Bcas3 T A 11: 85,361,663 (GRCm39) probably null Het
Bms1 G A 6: 118,385,095 (GRCm39) T371M possibly damaging Het
Camta1 C A 4: 151,159,597 (GRCm39) R1614L probably damaging Het
Capn3 T C 2: 120,318,546 (GRCm39) probably benign Het
Ccdc180 A G 4: 45,923,534 (GRCm39) D1105G probably damaging Het
Ccdc33 G T 9: 57,965,675 (GRCm39) P364Q probably damaging Het
Clstn3 A G 6: 124,408,699 (GRCm39) probably benign Het
Cntrl A T 2: 35,041,744 (GRCm39) Y619F possibly damaging Het
Col12a1 A T 9: 79,538,023 (GRCm39) Y2514* probably null Het
Cpt1b T C 15: 89,304,162 (GRCm39) H503R probably benign Het
Crb1 T A 1: 139,251,073 (GRCm39) T293S possibly damaging Het
D130043K22Rik C T 13: 25,042,028 (GRCm39) T319I possibly damaging Het
Dnaaf10 T C 11: 17,179,821 (GRCm39) I274T probably benign Het
Dzip1l G A 9: 99,543,051 (GRCm39) R502Q probably benign Het
Efcab5 A G 11: 77,020,702 (GRCm39) M673T probably damaging Het
Efcab5 G A 11: 77,031,749 (GRCm39) R42W probably damaging Het
F2rl3 A G 8: 73,489,426 (GRCm39) T218A probably benign Het
Fam135a C T 1: 24,107,045 (GRCm39) R31H probably damaging Het
Fcer2a A T 8: 3,739,811 (GRCm39) N53K possibly damaging Het
Golgb1 A C 16: 36,734,238 (GRCm39) K1162Q probably damaging Het
Gpr137b A T 13: 13,542,160 (GRCm39) probably benign Het
Haspin A T 11: 73,027,313 (GRCm39) L592Q probably damaging Het
Helq A G 5: 100,938,013 (GRCm39) F478L probably damaging Het
Iho1 A T 9: 108,305,639 (GRCm39) M11K possibly damaging Het
Il17rb T A 14: 29,726,337 (GRCm39) T84S probably damaging Het
Itga4 T C 2: 79,151,837 (GRCm39) L880P probably damaging Het
Itih5 A G 2: 10,190,375 (GRCm39) I61V possibly damaging Het
Ivl G A 3: 92,478,821 (GRCm39) L415F unknown Het
Kif2a A G 13: 107,113,158 (GRCm39) probably benign Het
Kmt2d T C 15: 98,748,192 (GRCm39) probably benign Het
Lars2 A G 9: 123,267,186 (GRCm39) probably benign Het
Lilrb4a T C 10: 51,367,677 (GRCm39) V73A probably benign Het
Lratd2 G T 15: 60,695,523 (GRCm39) Y74* probably null Het
Lrrc8a A G 2: 30,146,800 (GRCm39) D538G possibly damaging Het
Lrrk1 G A 7: 65,946,011 (GRCm39) probably benign Het
Mc2r A T 18: 68,541,203 (GRCm39) I30K possibly damaging Het
Mybbp1a C A 11: 72,340,933 (GRCm39) probably null Het
Napg C T 18: 63,120,034 (GRCm39) R149C probably damaging Het
Ncam2 A G 16: 81,314,517 (GRCm39) probably benign Het
Nlk T C 11: 78,462,301 (GRCm39) I509V probably benign Het
Nlrp2 A T 7: 5,331,108 (GRCm39) N429K probably benign Het
Nlrp9b A G 7: 19,762,423 (GRCm39) T247A probably benign Het
Noxo1 A T 17: 24,919,136 (GRCm39) probably null Het
Or1n1b A T 2: 36,780,035 (GRCm39) M275K probably benign Het
Or2ag2b A T 7: 106,417,904 (GRCm39) I205L probably benign Het
Or3a10 A G 11: 73,935,944 (GRCm39) I52T probably damaging Het
Or4c107 T A 2: 88,789,099 (GRCm39) C96* probably null Het
Or4m1 C A 14: 50,557,636 (GRCm39) A219S probably benign Het
Oxr1 T C 15: 41,683,458 (GRCm39) S294P probably damaging Het
Pfpl A G 19: 12,406,601 (GRCm39) Y284C probably damaging Het
Pi16 A T 17: 29,545,917 (GRCm39) T232S probably benign Het
Plcxd2 A T 16: 45,830,070 (GRCm39) N50K probably benign Het
Plekhn1 T A 4: 156,312,703 (GRCm39) N52Y probably damaging Het
Prl2c5 T C 13: 13,357,634 (GRCm39) probably benign Het
Prrc2b G A 2: 32,109,666 (GRCm39) V1080I probably damaging Het
Psg28 A T 7: 18,164,321 (GRCm39) N130K probably benign Het
Psme4 C A 11: 30,761,980 (GRCm39) T440K probably damaging Het
Ptcd2 T C 13: 99,458,104 (GRCm39) K296E probably benign Het
Ptprq T C 10: 107,378,596 (GRCm39) probably null Het
Rab5b A C 10: 128,522,615 (GRCm39) probably null Het
Rft1 T A 14: 30,412,540 (GRCm39) S534T probably benign Het
Rif1 GCCACCA GCCA 2: 52,000,336 (GRCm39) probably benign Het
Rsu1 A T 2: 13,174,946 (GRCm39) probably benign Het
Senp6 A G 9: 80,044,029 (GRCm39) M887V probably benign Het
Sgcz T A 8: 38,420,073 (GRCm39) M60L probably benign Het
Siglec1 G A 2: 130,925,861 (GRCm39) Q282* probably null Het
Sipa1l2 T C 8: 126,148,679 (GRCm39) T1655A probably damaging Het
Slc28a2b T A 2: 122,352,409 (GRCm39) S389T probably damaging Het
Slc43a3 G A 2: 84,768,007 (GRCm39) probably benign Het
Snx29 T C 16: 11,556,237 (GRCm39) V756A probably benign Het
Stk3 A C 15: 35,099,615 (GRCm39) S104A probably damaging Het
Stk38 C A 17: 29,211,390 (GRCm39) probably null Het
Stx6 T C 1: 155,049,909 (GRCm39) probably benign Het
Thbs4 G A 13: 92,912,040 (GRCm39) T230I probably benign Het
Thrsp A G 7: 97,066,709 (GRCm39) M1T probably null Het
Tmem63b A T 17: 45,986,299 (GRCm39) probably benign Het
Top2a A G 11: 98,900,733 (GRCm39) probably benign Het
Tpd52l2 T C 2: 181,143,852 (GRCm39) probably null Het
Trak1 A G 9: 121,283,404 (GRCm39) E390G probably damaging Het
Trappc3 T A 4: 126,167,745 (GRCm39) D101E possibly damaging Het
Trhr A G 15: 44,060,482 (GRCm39) M1V probably null Het
Triobp T A 15: 78,857,876 (GRCm39) I1159K probably benign Het
Unc45a A G 7: 79,976,045 (GRCm39) probably benign Het
Usb1 A G 8: 96,060,085 (GRCm39) D12G probably damaging Het
Ushbp1 C T 8: 71,847,293 (GRCm39) C113Y possibly damaging Het
Vim A G 2: 13,579,670 (GRCm39) K143R probably benign Het
Vmn2r75 T C 7: 85,797,515 (GRCm39) K766R probably benign Het
Xpo5 T G 17: 46,552,433 (GRCm39) C1089G probably damaging Het
Other mutations in Spta1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00979:Spta1 APN 1 174,035,956 (GRCm39) nonsense probably null
IGL01095:Spta1 APN 1 174,041,051 (GRCm39) missense probably benign 0.02
IGL01144:Spta1 APN 1 174,014,829 (GRCm39) missense probably benign 0.05
IGL01455:Spta1 APN 1 174,030,877 (GRCm39) missense possibly damaging 0.78
IGL01541:Spta1 APN 1 174,044,725 (GRCm39) missense probably benign 0.03
IGL01613:Spta1 APN 1 174,035,960 (GRCm39) missense probably damaging 1.00
IGL01804:Spta1 APN 1 174,071,746 (GRCm39) missense probably benign 0.42
IGL01859:Spta1 APN 1 174,001,938 (GRCm39) missense probably damaging 1.00
IGL01898:Spta1 APN 1 174,041,428 (GRCm39) missense probably benign 0.00
IGL02106:Spta1 APN 1 174,030,860 (GRCm39) missense probably benign 0.02
IGL02166:Spta1 APN 1 174,017,797 (GRCm39) missense probably damaging 1.00
IGL02224:Spta1 APN 1 174,045,255 (GRCm39) critical splice donor site probably benign
IGL02318:Spta1 APN 1 174,002,029 (GRCm39) missense possibly damaging 0.51
IGL02392:Spta1 APN 1 174,046,380 (GRCm39) missense probably damaging 0.96
IGL02852:Spta1 APN 1 174,071,676 (GRCm39) missense probably benign 0.24
IGL02861:Spta1 APN 1 174,039,164 (GRCm39) missense probably damaging 1.00
IGL02982:Spta1 APN 1 174,014,854 (GRCm39) missense probably benign 0.00
IGL03057:Spta1 APN 1 174,008,624 (GRCm39) missense probably benign 0.19
IGL03215:Spta1 APN 1 174,046,309 (GRCm39) missense probably damaging 1.00
IGL03263:Spta1 APN 1 174,041,484 (GRCm39) missense probably damaging 0.99
IGL03272:Spta1 APN 1 174,041,710 (GRCm39) missense probably benign 0.08
bounced UTSW 1 174,052,023 (GRCm39) missense probably damaging 1.00
Capillus UTSW 1 174,045,254 (GRCm39) critical splice donor site probably null
Deflection UTSW 1 174,068,653 (GRCm39) missense probably damaging 1.00
Goldfoil UTSW 1 174,046,078 (GRCm39) missense probably damaging 1.00
hanging UTSW 1 174,006,315 (GRCm39) missense probably damaging 0.99
Klimt UTSW 1 174,029,952 (GRCm39) missense probably damaging 1.00
Rutherford UTSW 1 174,034,676 (GRCm39) missense probably null 1.00
Thread UTSW 1 174,025,201 (GRCm39) nonsense probably null
H8786:Spta1 UTSW 1 174,007,405 (GRCm39) missense probably damaging 0.98
R0003:Spta1 UTSW 1 174,032,839 (GRCm39) missense probably damaging 0.98
R0003:Spta1 UTSW 1 174,032,839 (GRCm39) missense probably damaging 0.98
R0010:Spta1 UTSW 1 174,045,509 (GRCm39) missense probably benign 0.03
R0010:Spta1 UTSW 1 174,045,509 (GRCm39) missense probably benign 0.03
R0078:Spta1 UTSW 1 174,034,598 (GRCm39) splice site probably benign
R0172:Spta1 UTSW 1 174,058,352 (GRCm39) missense probably damaging 1.00
R0206:Spta1 UTSW 1 174,020,526 (GRCm39) missense probably damaging 1.00
R0208:Spta1 UTSW 1 174,020,526 (GRCm39) missense probably damaging 1.00
R0288:Spta1 UTSW 1 174,070,745 (GRCm39) missense probably damaging 0.99
R0323:Spta1 UTSW 1 174,046,017 (GRCm39) missense probably damaging 1.00
R0454:Spta1 UTSW 1 174,041,508 (GRCm39) missense probably damaging 1.00
R0508:Spta1 UTSW 1 174,052,023 (GRCm39) missense probably damaging 1.00
R0698:Spta1 UTSW 1 174,008,670 (GRCm39) missense probably damaging 1.00
R0751:Spta1 UTSW 1 174,012,256 (GRCm39) missense probably damaging 1.00
R0925:Spta1 UTSW 1 174,001,992 (GRCm39) missense possibly damaging 0.85
R0941:Spta1 UTSW 1 174,072,771 (GRCm39) unclassified probably benign
R1131:Spta1 UTSW 1 174,013,213 (GRCm39) missense probably damaging 1.00
R1171:Spta1 UTSW 1 174,039,180 (GRCm39) nonsense probably null
R1184:Spta1 UTSW 1 174,012,256 (GRCm39) missense probably damaging 1.00
R1401:Spta1 UTSW 1 174,050,250 (GRCm39) missense probably damaging 1.00
R1489:Spta1 UTSW 1 174,058,891 (GRCm39) missense probably damaging 0.97
R1532:Spta1 UTSW 1 174,074,919 (GRCm39) missense probably damaging 0.99
R1551:Spta1 UTSW 1 174,067,732 (GRCm39) missense possibly damaging 0.94
R1555:Spta1 UTSW 1 174,006,315 (GRCm39) missense probably damaging 0.99
R1566:Spta1 UTSW 1 174,012,272 (GRCm39) missense probably benign 0.00
R1586:Spta1 UTSW 1 174,041,061 (GRCm39) missense probably benign 0.00
R1676:Spta1 UTSW 1 174,007,405 (GRCm39) missense probably damaging 0.98
R1711:Spta1 UTSW 1 174,068,608 (GRCm39) missense probably damaging 1.00
R1795:Spta1 UTSW 1 174,073,296 (GRCm39) missense probably damaging 1.00
R1823:Spta1 UTSW 1 174,074,115 (GRCm39) missense probably benign 0.05
R1842:Spta1 UTSW 1 174,023,513 (GRCm39) missense probably benign 0.00
R1867:Spta1 UTSW 1 174,047,405 (GRCm39) missense probably benign 0.33
R1970:Spta1 UTSW 1 174,067,933 (GRCm39) missense possibly damaging 0.88
R2042:Spta1 UTSW 1 174,039,213 (GRCm39) missense probably benign 0.20
R2095:Spta1 UTSW 1 174,071,764 (GRCm39) missense possibly damaging 0.75
R2125:Spta1 UTSW 1 174,035,910 (GRCm39) missense possibly damaging 0.80
R2145:Spta1 UTSW 1 174,040,180 (GRCm39) missense probably benign 0.00
R2158:Spta1 UTSW 1 174,056,824 (GRCm39) missense probably benign 0.41
R2187:Spta1 UTSW 1 174,020,532 (GRCm39) missense probably damaging 1.00
R2250:Spta1 UTSW 1 174,071,680 (GRCm39) missense probably damaging 1.00
R2258:Spta1 UTSW 1 174,001,907 (GRCm39) missense possibly damaging 0.76
R2319:Spta1 UTSW 1 174,006,222 (GRCm39) critical splice acceptor site probably null
R3782:Spta1 UTSW 1 174,035,880 (GRCm39) missense probably damaging 1.00
R4058:Spta1 UTSW 1 174,068,703 (GRCm39) missense probably damaging 1.00
R4080:Spta1 UTSW 1 174,041,632 (GRCm39) missense probably benign 0.00
R4081:Spta1 UTSW 1 174,041,632 (GRCm39) missense probably benign 0.00
R4082:Spta1 UTSW 1 174,041,632 (GRCm39) missense probably benign 0.00
R4108:Spta1 UTSW 1 174,002,122 (GRCm39) missense probably benign 0.01
R4115:Spta1 UTSW 1 174,067,923 (GRCm39) missense probably damaging 1.00
R4303:Spta1 UTSW 1 174,007,418 (GRCm39) missense probably damaging 1.00
R4419:Spta1 UTSW 1 174,074,990 (GRCm39) nonsense probably null
R4525:Spta1 UTSW 1 174,034,676 (GRCm39) missense probably null 1.00
R4614:Spta1 UTSW 1 174,020,543 (GRCm39) missense probably damaging 1.00
R4673:Spta1 UTSW 1 174,018,628 (GRCm39) splice site probably null
R4782:Spta1 UTSW 1 174,058,232 (GRCm39) missense probably benign 0.01
R4825:Spta1 UTSW 1 174,071,608 (GRCm39) critical splice acceptor site probably null
R4829:Spta1 UTSW 1 174,065,493 (GRCm39) missense probably benign 0.01
R4873:Spta1 UTSW 1 174,003,396 (GRCm39) missense probably damaging 1.00
R4875:Spta1 UTSW 1 174,003,396 (GRCm39) missense probably damaging 1.00
R4898:Spta1 UTSW 1 174,065,400 (GRCm39) missense possibly damaging 0.94
R4910:Spta1 UTSW 1 174,045,429 (GRCm39) splice site probably null
R4911:Spta1 UTSW 1 174,013,213 (GRCm39) missense probably damaging 1.00
R4928:Spta1 UTSW 1 174,018,622 (GRCm39) missense probably benign 0.15
R4959:Spta1 UTSW 1 174,074,174 (GRCm39) missense probably damaging 0.97
R5009:Spta1 UTSW 1 174,067,789 (GRCm39) missense possibly damaging 0.62
R5149:Spta1 UTSW 1 174,075,000 (GRCm39) missense probably damaging 0.99
R5293:Spta1 UTSW 1 174,023,551 (GRCm39) missense probably damaging 0.99
R5421:Spta1 UTSW 1 174,043,095 (GRCm39) missense probably damaging 0.99
R5457:Spta1 UTSW 1 174,044,759 (GRCm39) missense probably damaging 1.00
R5590:Spta1 UTSW 1 174,003,336 (GRCm39) missense possibly damaging 0.73
R5606:Spta1 UTSW 1 174,047,468 (GRCm39) missense probably damaging 1.00
R5736:Spta1 UTSW 1 174,041,821 (GRCm39) critical splice donor site probably null
R5834:Spta1 UTSW 1 174,012,363 (GRCm39) splice site probably null
R5845:Spta1 UTSW 1 174,068,662 (GRCm39) missense probably damaging 0.97
R5987:Spta1 UTSW 1 174,050,894 (GRCm39) missense probably damaging 1.00
R6102:Spta1 UTSW 1 174,052,086 (GRCm39) missense probably benign 0.01
R6221:Spta1 UTSW 1 174,009,342 (GRCm39) missense probably damaging 1.00
R6276:Spta1 UTSW 1 174,046,078 (GRCm39) missense probably damaging 1.00
R6317:Spta1 UTSW 1 174,068,653 (GRCm39) missense probably damaging 1.00
R6329:Spta1 UTSW 1 174,041,743 (GRCm39) missense possibly damaging 0.60
R6352:Spta1 UTSW 1 174,039,212 (GRCm39) missense possibly damaging 0.94
R6374:Spta1 UTSW 1 174,041,734 (GRCm39) missense probably damaging 1.00
R6376:Spta1 UTSW 1 174,030,888 (GRCm39) missense probably benign
R6387:Spta1 UTSW 1 174,058,899 (GRCm39) missense probably benign 0.01
R6451:Spta1 UTSW 1 174,044,767 (GRCm39) missense probably damaging 0.97
R6480:Spta1 UTSW 1 174,014,714 (GRCm39) splice site probably null
R6533:Spta1 UTSW 1 174,071,713 (GRCm39) missense probably damaging 1.00
R6585:Spta1 UTSW 1 174,006,251 (GRCm39) missense probably damaging 1.00
R6695:Spta1 UTSW 1 174,071,608 (GRCm39) critical splice acceptor site probably null
R6945:Spta1 UTSW 1 174,036,891 (GRCm39) missense possibly damaging 0.89
R7020:Spta1 UTSW 1 174,036,918 (GRCm39) missense probably damaging 1.00
R7086:Spta1 UTSW 1 174,027,050 (GRCm39) missense probably damaging 0.98
R7087:Spta1 UTSW 1 174,002,076 (GRCm39) missense probably benign
R7151:Spta1 UTSW 1 174,025,317 (GRCm39) missense probably damaging 1.00
R7193:Spta1 UTSW 1 174,012,178 (GRCm39) missense probably damaging 1.00
R7199:Spta1 UTSW 1 174,050,837 (GRCm39) missense possibly damaging 0.61
R7219:Spta1 UTSW 1 174,050,203 (GRCm39) missense probably damaging 0.96
R7343:Spta1 UTSW 1 174,050,915 (GRCm39) missense probably damaging 0.99
R7372:Spta1 UTSW 1 174,025,201 (GRCm39) nonsense probably null
R7472:Spta1 UTSW 1 174,074,065 (GRCm39) missense probably damaging 1.00
R7516:Spta1 UTSW 1 174,025,349 (GRCm39) missense probably damaging 1.00
R7627:Spta1 UTSW 1 174,032,944 (GRCm39) missense probably damaging 1.00
R7770:Spta1 UTSW 1 174,023,547 (GRCm39) nonsense probably null
R7784:Spta1 UTSW 1 174,030,017 (GRCm39) missense probably damaging 1.00
R7804:Spta1 UTSW 1 174,023,471 (GRCm39) missense possibly damaging 0.50
R7854:Spta1 UTSW 1 174,046,396 (GRCm39) critical splice donor site probably null
R7862:Spta1 UTSW 1 174,025,351 (GRCm39) critical splice donor site probably null
R7958:Spta1 UTSW 1 174,001,956 (GRCm39) missense probably benign 0.03
R8015:Spta1 UTSW 1 174,067,737 (GRCm39) missense probably damaging 1.00
R8059:Spta1 UTSW 1 174,045,936 (GRCm39) intron probably benign
R8076:Spta1 UTSW 1 174,014,797 (GRCm39) missense probably benign 0.00
R8152:Spta1 UTSW 1 174,045,510 (GRCm39) missense probably benign 0.03
R8235:Spta1 UTSW 1 174,029,952 (GRCm39) missense probably damaging 1.00
R8284:Spta1 UTSW 1 174,007,387 (GRCm39) missense probably benign 0.00
R8298:Spta1 UTSW 1 174,074,953 (GRCm39) missense probably damaging 1.00
R8312:Spta1 UTSW 1 174,067,777 (GRCm39) missense probably damaging 1.00
R8495:Spta1 UTSW 1 174,043,051 (GRCm39) missense probably benign 0.00
R8550:Spta1 UTSW 1 174,014,774 (GRCm39) missense probably damaging 1.00
R8675:Spta1 UTSW 1 174,058,249 (GRCm39) missense probably benign 0.01
R8757:Spta1 UTSW 1 174,040,940 (GRCm39) missense probably damaging 1.00
R8759:Spta1 UTSW 1 174,040,940 (GRCm39) missense probably damaging 1.00
R8848:Spta1 UTSW 1 174,025,310 (GRCm39) missense probably benign 0.05
R8883:Spta1 UTSW 1 174,021,145 (GRCm39) missense possibly damaging 0.82
R8884:Spta1 UTSW 1 174,045,254 (GRCm39) critical splice donor site probably null
R8896:Spta1 UTSW 1 174,045,548 (GRCm39) missense probably damaging 1.00
R8953:Spta1 UTSW 1 174,058,241 (GRCm39) missense probably benign 0.10
R9006:Spta1 UTSW 1 174,047,537 (GRCm39) missense probably damaging 1.00
R9013:Spta1 UTSW 1 174,050,174 (GRCm39) missense probably damaging 1.00
R9077:Spta1 UTSW 1 174,045,170 (GRCm39) missense probably damaging 1.00
R9129:Spta1 UTSW 1 174,058,911 (GRCm39) missense possibly damaging 0.77
R9207:Spta1 UTSW 1 174,039,139 (GRCm39) missense probably benign 0.01
R9229:Spta1 UTSW 1 174,067,750 (GRCm39) missense probably damaging 1.00
R9281:Spta1 UTSW 1 174,047,444 (GRCm39) missense probably damaging 1.00
R9290:Spta1 UTSW 1 174,045,204 (GRCm39) missense possibly damaging 0.94
R9307:Spta1 UTSW 1 174,035,978 (GRCm39) missense probably damaging 1.00
R9489:Spta1 UTSW 1 174,035,880 (GRCm39) missense probably damaging 1.00
R9605:Spta1 UTSW 1 174,035,880 (GRCm39) missense probably damaging 1.00
R9685:Spta1 UTSW 1 174,032,925 (GRCm39) missense probably damaging 1.00
RF002:Spta1 UTSW 1 174,058,926 (GRCm39) missense possibly damaging 0.62
RF018:Spta1 UTSW 1 174,036,885 (GRCm39) missense probably damaging 1.00
RF020:Spta1 UTSW 1 174,045,469 (GRCm39) missense probably damaging 1.00
RF020:Spta1 UTSW 1 174,041,010 (GRCm39) missense probably benign 0.42
T0722:Spta1 UTSW 1 174,018,632 (GRCm39) splice site probably benign
X0028:Spta1 UTSW 1 174,052,016 (GRCm39) missense probably damaging 1.00
Z1176:Spta1 UTSW 1 174,067,933 (GRCm39) missense probably damaging 0.99
Z1176:Spta1 UTSW 1 174,018,617 (GRCm39) missense probably damaging 1.00
Z1177:Spta1 UTSW 1 174,073,255 (GRCm39) missense probably benign 0.02
Z1177:Spta1 UTSW 1 174,017,728 (GRCm39) missense probably benign 0.09
Predicted Primers PCR Primer
(F):5'- GCAGTCACCCTGATACTGAACACTC -3'
(R):5'- TGTCCAGTTGCTCCTAGCTCCAAG -3'

Sequencing Primer
(F):5'- CTTCTCTGGATGGTGAGGTGATA -3'
(R):5'- CCAAGGTGCTGAGTTACATGC -3'
Posted On 2013-05-09