Incidental Mutation 'R4714:Atp11b'
ID353421
Institutional Source Beutler Lab
Gene Symbol Atp11b
Ensembl Gene ENSMUSG00000037400
Gene NameATPase, class VI, type 11B
Synonyms1110019I14Rik
MMRRC Submission 041956-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.334) question?
Stock #R4714 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location35754106-35856276 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 35834394 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 738 (V738I)
Ref Sequence ENSEMBL: ENSMUSP00000142676 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029257] [ENSMUST00000198599]
Predicted Effect probably benign
Transcript: ENSMUST00000029257
AA Change: V938I

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000029257
Gene: ENSMUSG00000037400
AA Change: V938I

DomainStartEndE-ValueType
Pfam:PhoLip_ATPase_N 21 90 2.4e-24 PFAM
Pfam:E1-E2_ATPase 95 369 5.4e-13 PFAM
Pfam:Hydrolase 401 757 1.5e-10 PFAM
Pfam:HAD 404 829 5.9e-20 PFAM
Pfam:Cation_ATPase 492 605 7.1e-13 PFAM
Pfam:PhoLip_ATPase_C 846 1099 1.5e-76 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000196409
Predicted Effect noncoding transcript
Transcript: ENSMUST00000196700
Predicted Effect probably benign
Transcript: ENSMUST00000197764
Predicted Effect probably benign
Transcript: ENSMUST00000198599
AA Change: V738I

PolyPhen 2 Score 0.016 (Sensitivity: 0.95; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000142676
Gene: ENSMUSG00000037400
AA Change: V738I

DomainStartEndE-ValueType
low complexity region 90 107 N/A INTRINSIC
Pfam:Hydrolase 201 632 3e-17 PFAM
Pfam:HAD 204 629 4e-16 PFAM
Pfam:Hydrolase_like2 292 405 1.2e-13 PFAM
low complexity region 833 848 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000200445
Predicted Effect probably benign
Transcript: ENSMUST00000211902
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] P-type ATPases, such as ATP11B, are phosphorylated in their intermediate state and drive uphill transport of ions across membranes. Several subfamilies of P-type ATPases have been identified. One subfamily transports heavy metal ions, such as Cu(2+) or Cd(2+). Another subfamily transports non-heavy metal ions, such as H(+), Na(+), K(+), or Ca(+). A third subfamily transports amphipaths, such as phosphatidylserine.[supplied by OMIM, Feb 2005]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700049A03Rik G T 12: 71,164,546 E685* probably null Het
2700049A03Rik A T 12: 71,164,547 E685V possibly damaging Het
4930486L24Rik A G 13: 60,844,318 V298A probably damaging Het
Abca12 A G 1: 71,321,450 V534A probably benign Het
Abcb4 A G 5: 8,930,906 probably null Het
Adam30 A T 3: 98,162,854 S668C probably damaging Het
Ap1g1 T A 8: 109,829,620 V196D probably damaging Het
Cast C T 13: 74,798,715 V27I probably damaging Het
Cfap54 A G 10: 92,815,918 I3090T probably benign Het
Cgn C A 3: 94,779,438 G185W probably damaging Het
Champ1 T C 8: 13,878,063 Y74H probably damaging Het
Cpm T C 10: 117,675,985 I278T probably damaging Het
Dcaf15 T C 8: 84,102,216 T141A probably benign Het
Dcun1d1 C T 3: 35,895,670 V244M probably damaging Het
Defb8 A G 8: 19,447,559 L12P probably damaging Het
Dlg1 A T 16: 31,790,261 I225F probably damaging Het
Dync2h1 G T 9: 7,118,932 H2178N possibly damaging Het
Enam A G 5: 88,503,536 E893G probably damaging Het
Flt4 T A 11: 49,627,207 L358Q probably damaging Het
Frmpd1 A G 4: 45,284,785 Q1202R probably benign Het
Ghr T A 15: 3,320,397 D433V possibly damaging Het
Grm7 G A 6: 111,080,422 D328N possibly damaging Het
Haus4 T C 14: 54,542,120 D349G probably benign Het
Helz T C 11: 107,626,716 probably null Het
Hif3a A G 7: 17,056,271 L69P probably damaging Het
Ifit1 A G 19: 34,648,163 E233G probably damaging Het
Kcnc2 T C 10: 112,455,828 F307S possibly damaging Het
Lrp1b A T 2: 41,110,759 V2151E possibly damaging Het
Lrp5 T C 19: 3,659,454 N92S probably damaging Het
Metrnl C T 11: 121,716,013 A216V probably damaging Het
Msh2 A G 17: 87,718,789 T732A probably damaging Het
Necab2 T C 8: 119,467,595 L270P probably damaging Het
Noc3l T C 19: 38,815,713 K74E probably benign Het
Oas2 A T 5: 120,733,472 L702Q probably damaging Het
Olfr136 A C 17: 38,335,840 I228L possibly damaging Het
Olfr3 A T 2: 36,813,035 I19N probably benign Het
Olfr728 A G 14: 50,139,979 I220T possibly damaging Het
Olfr731 C A 14: 50,238,367 V173L possibly damaging Het
Olfr812 A T 10: 129,842,945 N32K probably damaging Het
Pax6 A G 2: 105,695,400 H376R possibly damaging Het
Pnkd C T 1: 74,351,782 R376C probably damaging Het
Pnpla8 T C 12: 44,295,913 F484S probably damaging Het
Psme4 T A 11: 30,832,573 H909Q probably benign Het
Rasip1 CGG CGGG 7: 45,632,396 probably null Het
Rbm47 A T 5: 66,025,052 Y413N probably damaging Het
Rnf123 A G 9: 108,052,439 probably null Het
Ruvbl1 T A 6: 88,484,430 M259K possibly damaging Het
Sohlh2 A G 3: 55,190,529 H134R probably benign Het
Sorbs2 A G 8: 45,795,293 D447G possibly damaging Het
Tank C T 2: 61,650,229 P370S probably benign Het
Tenm4 A G 7: 96,894,924 E2049G probably damaging Het
Tnik A G 3: 28,594,077 H426R possibly damaging Het
Trpm6 C A 19: 18,854,200 S1476R possibly damaging Het
Trpm7 G A 2: 126,840,783 Q389* probably null Het
Ttc28 G A 5: 111,285,229 R2043Q possibly damaging Het
Tymp A G 15: 89,376,307 S103P probably damaging Het
Usp40 C T 1: 87,967,179 probably null Het
Vmn1r202 T A 13: 22,501,807 N147Y probably damaging Het
Vmn2r89 T C 14: 51,452,231 S64P probably damaging Het
Vps13a A T 19: 16,749,856 D229E probably benign Het
Vps52 A G 17: 33,961,179 I354V probably benign Het
Zbtb8os T C 4: 129,341,764 F90L probably damaging Het
Zfp36l1 T C 12: 80,110,496 D37G possibly damaging Het
Zfp467 A G 6: 48,427,817 S109P unknown Het
Zzef1 T A 11: 72,837,212 C535S probably damaging Het
Other mutations in Atp11b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00089:Atp11b APN 3 35809376 unclassified probably null
IGL00722:Atp11b APN 3 35819935 missense probably damaging 1.00
IGL00725:Atp11b APN 3 35827073 missense probably damaging 0.97
IGL01514:Atp11b APN 3 35836981 missense probably damaging 1.00
IGL01532:Atp11b APN 3 35849502 nonsense probably null
IGL01789:Atp11b APN 3 35789592 missense possibly damaging 0.81
IGL01915:Atp11b APN 3 35831463 missense probably damaging 1.00
IGL02009:Atp11b APN 3 35814152 missense probably benign 0.07
IGL02049:Atp11b APN 3 35800493 missense probably damaging 0.99
IGL02952:Atp11b APN 3 35828695 missense probably damaging 1.00
IGL02991:Atp11b UTSW 3 35826991 missense probably benign 0.00
R0044:Atp11b UTSW 3 35812252 missense probably damaging 0.99
R0254:Atp11b UTSW 3 35812110 missense possibly damaging 0.82
R0538:Atp11b UTSW 3 35837014 missense probably damaging 1.00
R0541:Atp11b UTSW 3 35806944 missense probably damaging 0.99
R0653:Atp11b UTSW 3 35839194 missense probably damaging 0.99
R0790:Atp11b UTSW 3 35832923 missense probably damaging 1.00
R1083:Atp11b UTSW 3 35778013 splice site probably benign
R1371:Atp11b UTSW 3 35806769 missense probably damaging 0.97
R1458:Atp11b UTSW 3 35789558 missense probably damaging 1.00
R1875:Atp11b UTSW 3 35839147 missense probably damaging 1.00
R1921:Atp11b UTSW 3 35834325 missense probably damaging 1.00
R2008:Atp11b UTSW 3 35855122 missense probably damaging 0.97
R2065:Atp11b UTSW 3 35839074 missense probably damaging 1.00
R2112:Atp11b UTSW 3 35837528 missense probably damaging 1.00
R2228:Atp11b UTSW 3 35806942 missense probably damaging 1.00
R2270:Atp11b UTSW 3 35810134 unclassified probably null
R2273:Atp11b UTSW 3 35828613 missense probably benign 0.04
R2439:Atp11b UTSW 3 35814084 missense possibly damaging 0.68
R2497:Atp11b UTSW 3 35855145 missense probably damaging 0.99
R4181:Atp11b UTSW 3 35789558 missense probably damaging 1.00
R4181:Atp11b UTSW 3 35800565 missense probably benign 0.19
R4923:Atp11b UTSW 3 35835379 critical splice donor site probably null
R4937:Atp11b UTSW 3 35807008 unclassified probably null
R5013:Atp11b UTSW 3 35834383 missense possibly damaging 0.66
R5058:Atp11b UTSW 3 35809361 missense probably benign 0.41
R5171:Atp11b UTSW 3 35832937 missense probably damaging 1.00
R5200:Atp11b UTSW 3 35837007 missense probably benign 0.21
R5465:Atp11b UTSW 3 35810184 missense probably benign 0.00
R5651:Atp11b UTSW 3 35855140 missense probably damaging 1.00
R5689:Atp11b UTSW 3 35834352 missense possibly damaging 0.67
R5718:Atp11b UTSW 3 35837516 missense probably benign 0.12
R5807:Atp11b UTSW 3 35812279 missense probably damaging 1.00
R5888:Atp11b UTSW 3 35837547 missense probably benign 0.15
R6059:Atp11b UTSW 3 35814177 missense possibly damaging 0.72
R6259:Atp11b UTSW 3 35806901 missense probably damaging 1.00
R6359:Atp11b UTSW 3 35778061 missense probably benign 0.04
R6367:Atp11b UTSW 3 35784537 missense probably damaging 1.00
R6577:Atp11b UTSW 3 35839162 missense probably damaging 0.99
R6818:Atp11b UTSW 3 35814180 missense possibly damaging 0.71
R7016:Atp11b UTSW 3 35841036 missense probably benign
R7178:Atp11b UTSW 3 35819950 missense probably benign 0.34
R7729:Atp11b UTSW 3 35778107 missense probably damaging 0.97
Z1088:Atp11b UTSW 3 35812213 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCCTGACCAACTTAAGAGTCTTG -3'
(R):5'- TACAACAGTTTAAGGACAGAAGTGC -3'

Sequencing Primer
(F):5'- CTGACCAACTTAAGAGTCTTGAGATG -3'
(R):5'- GAAGTGCTTATTCCTAAAAACACTGG -3'
Posted On2015-10-21