Incidental Mutation 'R4714:Sohlh2'
ID353423
Institutional Source Beutler Lab
Gene Symbol Sohlh2
Ensembl Gene ENSMUSG00000027794
Gene Namespermatogenesis and oogenesis specific basic helix-loop-helix 2
Synonyms4933406N12Rik
MMRRC Submission 041956-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.652) question?
Stock #R4714 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location55182028-55209957 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 55190529 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Arginine at position 134 (H134R)
Ref Sequence ENSEMBL: ENSMUSP00000029369 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029369]
Predicted Effect probably benign
Transcript: ENSMUST00000029369
AA Change: H134R

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000029369
Gene: ENSMUSG00000027794
AA Change: H134R

DomainStartEndE-ValueType
HLH 206 257 4.2e-8 SMART
low complexity region 426 446 N/A INTRINSIC
low complexity region 449 461 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This locus represents naturally occurring read-through transcription between the neighboring C13orf38 (chromosome 13 open reading frame 38) and SOHLH2 (spermatogenesis and oogenesis specific basic helix-loop-helix 2) genes. The read-through transcript encodes a fusion protein that shares sequence identity with the products of each individual gene. [provided by RefSeq, Nov 2010]
PHENOTYPE: Homozygous inactivation of this gene leads to female and male infertility due to defects in early oocyte and spermatogonial differentiation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700049A03Rik G T 12: 71,164,546 E685* probably null Het
2700049A03Rik A T 12: 71,164,547 E685V possibly damaging Het
4930486L24Rik A G 13: 60,844,318 V298A probably damaging Het
Abca12 A G 1: 71,321,450 V534A probably benign Het
Abcb4 A G 5: 8,930,906 probably null Het
Adam30 A T 3: 98,162,854 S668C probably damaging Het
Ap1g1 T A 8: 109,829,620 V196D probably damaging Het
Atp11b G A 3: 35,834,394 V738I probably benign Het
Cast C T 13: 74,798,715 V27I probably damaging Het
Cfap54 A G 10: 92,815,918 I3090T probably benign Het
Cgn C A 3: 94,779,438 G185W probably damaging Het
Champ1 T C 8: 13,878,063 Y74H probably damaging Het
Cpm T C 10: 117,675,985 I278T probably damaging Het
Dcaf15 T C 8: 84,102,216 T141A probably benign Het
Dcun1d1 C T 3: 35,895,670 V244M probably damaging Het
Defb8 A G 8: 19,447,559 L12P probably damaging Het
Dlg1 A T 16: 31,790,261 I225F probably damaging Het
Dync2h1 G T 9: 7,118,932 H2178N possibly damaging Het
Enam A G 5: 88,503,536 E893G probably damaging Het
Flt4 T A 11: 49,627,207 L358Q probably damaging Het
Frmpd1 A G 4: 45,284,785 Q1202R probably benign Het
Ghr T A 15: 3,320,397 D433V possibly damaging Het
Grm7 G A 6: 111,080,422 D328N possibly damaging Het
Haus4 T C 14: 54,542,120 D349G probably benign Het
Helz T C 11: 107,626,716 probably null Het
Hif3a A G 7: 17,056,271 L69P probably damaging Het
Ifit1 A G 19: 34,648,163 E233G probably damaging Het
Kcnc2 T C 10: 112,455,828 F307S possibly damaging Het
Lrp1b A T 2: 41,110,759 V2151E possibly damaging Het
Lrp5 T C 19: 3,659,454 N92S probably damaging Het
Metrnl C T 11: 121,716,013 A216V probably damaging Het
Msh2 A G 17: 87,718,789 T732A probably damaging Het
Necab2 T C 8: 119,467,595 L270P probably damaging Het
Noc3l T C 19: 38,815,713 K74E probably benign Het
Oas2 A T 5: 120,733,472 L702Q probably damaging Het
Olfr136 A C 17: 38,335,840 I228L possibly damaging Het
Olfr3 A T 2: 36,813,035 I19N probably benign Het
Olfr728 A G 14: 50,139,979 I220T possibly damaging Het
Olfr731 C A 14: 50,238,367 V173L possibly damaging Het
Olfr812 A T 10: 129,842,945 N32K probably damaging Het
Pax6 A G 2: 105,695,400 H376R possibly damaging Het
Pnkd C T 1: 74,351,782 R376C probably damaging Het
Pnpla8 T C 12: 44,295,913 F484S probably damaging Het
Psme4 T A 11: 30,832,573 H909Q probably benign Het
Rasip1 CGG CGGG 7: 45,632,396 probably null Het
Rbm47 A T 5: 66,025,052 Y413N probably damaging Het
Rnf123 A G 9: 108,052,439 probably null Het
Ruvbl1 T A 6: 88,484,430 M259K possibly damaging Het
Sorbs2 A G 8: 45,795,293 D447G possibly damaging Het
Tank C T 2: 61,650,229 P370S probably benign Het
Tenm4 A G 7: 96,894,924 E2049G probably damaging Het
Tnik A G 3: 28,594,077 H426R possibly damaging Het
Trpm6 C A 19: 18,854,200 S1476R possibly damaging Het
Trpm7 G A 2: 126,840,783 Q389* probably null Het
Ttc28 G A 5: 111,285,229 R2043Q possibly damaging Het
Tymp A G 15: 89,376,307 S103P probably damaging Het
Usp40 C T 1: 87,967,179 probably null Het
Vmn1r202 T A 13: 22,501,807 N147Y probably damaging Het
Vmn2r89 T C 14: 51,452,231 S64P probably damaging Het
Vps13a A T 19: 16,749,856 D229E probably benign Het
Vps52 A G 17: 33,961,179 I354V probably benign Het
Zbtb8os T C 4: 129,341,764 F90L probably damaging Het
Zfp36l1 T C 12: 80,110,496 D37G possibly damaging Het
Zfp467 A G 6: 48,427,817 S109P unknown Het
Zzef1 T A 11: 72,837,212 C535S probably damaging Het
Other mutations in Sohlh2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00092:Sohlh2 APN 3 55207815 missense probably damaging 1.00
IGL00574:Sohlh2 APN 3 55204326 splice site probably benign
IGL01434:Sohlh2 APN 3 55195161 missense probably damaging 1.00
IGL02200:Sohlh2 APN 3 55190556 missense probably damaging 1.00
R0362:Sohlh2 UTSW 3 55207742 missense probably damaging 1.00
R0540:Sohlh2 UTSW 3 55207683 missense probably damaging 0.99
R0607:Sohlh2 UTSW 3 55207683 missense probably damaging 0.99
R0732:Sohlh2 UTSW 3 55190373 critical splice donor site probably null
R1878:Sohlh2 UTSW 3 55207643 missense probably damaging 0.97
R2001:Sohlh2 UTSW 3 55192341 splice site probably null
R2070:Sohlh2 UTSW 3 55207622 missense probably benign 0.18
R2071:Sohlh2 UTSW 3 55207622 missense probably benign 0.18
R4412:Sohlh2 UTSW 3 55197002 missense probably damaging 1.00
R4413:Sohlh2 UTSW 3 55197002 missense probably damaging 1.00
R5709:Sohlh2 UTSW 3 55192302 missense probably benign 0.03
R5818:Sohlh2 UTSW 3 55190501 missense probably damaging 1.00
R6173:Sohlh2 UTSW 3 55196998 missense probably benign 0.26
R6822:Sohlh2 UTSW 3 55207686 missense probably damaging 1.00
R6850:Sohlh2 UTSW 3 55192286 missense probably benign 0.05
X0023:Sohlh2 UTSW 3 55196776 missense probably benign 0.07
Predicted Primers PCR Primer
(F):5'- TTCCCCTCAGATCTGGCAAG -3'
(R):5'- GTGCAATTCCAAGTTAATGCCC -3'

Sequencing Primer
(F):5'- GAAAAACACACATTTGCTGTTTGC -3'
(R):5'- CCAAGTTAATGCCCTACTTTTTGG -3'
Posted On2015-10-21