Incidental Mutation 'R4714:Cgn'
ID353424
Institutional Source Beutler Lab
Gene Symbol Cgn
Ensembl Gene ENSMUSG00000068876
Gene Namecingulin
Synonyms6330408J11Rik
MMRRC Submission 041956-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4714 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location94760069-94786492 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 94779438 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Tryptophan at position 185 (G185W)
Ref Sequence ENSEMBL: ENSMUSP00000142809 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000107272] [ENSMUST00000107273] [ENSMUST00000153263] [ENSMUST00000155485]
Predicted Effect probably damaging
Transcript: ENSMUST00000107272
AA Change: G185W

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000102893
Gene: ENSMUSG00000068876
AA Change: G185W

DomainStartEndE-ValueType
low complexity region 31 43 N/A INTRINSIC
low complexity region 189 198 N/A INTRINSIC
internal_repeat_1 214 229 8.06e-5 PROSPERO
low complexity region 242 260 N/A INTRINSIC
internal_repeat_1 287 302 8.06e-5 PROSPERO
low complexity region 446 462 N/A INTRINSIC
low complexity region 466 481 N/A INTRINSIC
low complexity region 536 549 N/A INTRINSIC
low complexity region 567 592 N/A INTRINSIC
low complexity region 660 676 N/A INTRINSIC
low complexity region 758 775 N/A INTRINSIC
Pfam:Myosin_tail_1 783 1140 3.4e-31 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000107273
AA Change: G185W

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000102894
Gene: ENSMUSG00000068876
AA Change: G185W

DomainStartEndE-ValueType
low complexity region 31 43 N/A INTRINSIC
low complexity region 189 198 N/A INTRINSIC
internal_repeat_1 214 229 8.83e-5 PROSPERO
low complexity region 242 260 N/A INTRINSIC
internal_repeat_1 287 302 8.83e-5 PROSPERO
low complexity region 454 470 N/A INTRINSIC
low complexity region 474 489 N/A INTRINSIC
low complexity region 544 557 N/A INTRINSIC
low complexity region 575 600 N/A INTRINSIC
low complexity region 668 684 N/A INTRINSIC
low complexity region 766 783 N/A INTRINSIC
Pfam:Myosin_tail_1 799 1144 2.2e-37 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000153263
AA Change: G185W

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000143156
Gene: ENSMUSG00000068876
AA Change: G185W

DomainStartEndE-ValueType
low complexity region 31 43 N/A INTRINSIC
low complexity region 189 198 N/A INTRINSIC
low complexity region 242 260 N/A INTRINSIC
coiled coil region 337 402 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000155485
AA Change: G185W

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000142809
Gene: ENSMUSG00000068876
AA Change: G185W

DomainStartEndE-ValueType
low complexity region 31 43 N/A INTRINSIC
low complexity region 189 198 N/A INTRINSIC
low complexity region 242 260 N/A INTRINSIC
low complexity region 340 357 N/A INTRINSIC
coiled coil region 381 447 N/A INTRINSIC
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.7%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased sensitivity to the ulcerogenic action of cysteamine. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700049A03Rik G T 12: 71,164,546 E685* probably null Het
2700049A03Rik A T 12: 71,164,547 E685V possibly damaging Het
4930486L24Rik A G 13: 60,844,318 V298A probably damaging Het
Abca12 A G 1: 71,321,450 V534A probably benign Het
Abcb4 A G 5: 8,930,906 probably null Het
Adam30 A T 3: 98,162,854 S668C probably damaging Het
Ap1g1 T A 8: 109,829,620 V196D probably damaging Het
Atp11b G A 3: 35,834,394 V738I probably benign Het
Cast C T 13: 74,798,715 V27I probably damaging Het
Cfap54 A G 10: 92,815,918 I3090T probably benign Het
Champ1 T C 8: 13,878,063 Y74H probably damaging Het
Cpm T C 10: 117,675,985 I278T probably damaging Het
Dcaf15 T C 8: 84,102,216 T141A probably benign Het
Dcun1d1 C T 3: 35,895,670 V244M probably damaging Het
Defb8 A G 8: 19,447,559 L12P probably damaging Het
Dlg1 A T 16: 31,790,261 I225F probably damaging Het
Dync2h1 G T 9: 7,118,932 H2178N possibly damaging Het
Enam A G 5: 88,503,536 E893G probably damaging Het
Flt4 T A 11: 49,627,207 L358Q probably damaging Het
Frmpd1 A G 4: 45,284,785 Q1202R probably benign Het
Ghr T A 15: 3,320,397 D433V possibly damaging Het
Grm7 G A 6: 111,080,422 D328N possibly damaging Het
Haus4 T C 14: 54,542,120 D349G probably benign Het
Helz T C 11: 107,626,716 probably null Het
Hif3a A G 7: 17,056,271 L69P probably damaging Het
Ifit1 A G 19: 34,648,163 E233G probably damaging Het
Kcnc2 T C 10: 112,455,828 F307S possibly damaging Het
Lrp1b A T 2: 41,110,759 V2151E possibly damaging Het
Lrp5 T C 19: 3,659,454 N92S probably damaging Het
Metrnl C T 11: 121,716,013 A216V probably damaging Het
Msh2 A G 17: 87,718,789 T732A probably damaging Het
Necab2 T C 8: 119,467,595 L270P probably damaging Het
Noc3l T C 19: 38,815,713 K74E probably benign Het
Oas2 A T 5: 120,733,472 L702Q probably damaging Het
Olfr136 A C 17: 38,335,840 I228L possibly damaging Het
Olfr3 A T 2: 36,813,035 I19N probably benign Het
Olfr728 A G 14: 50,139,979 I220T possibly damaging Het
Olfr731 C A 14: 50,238,367 V173L possibly damaging Het
Olfr812 A T 10: 129,842,945 N32K probably damaging Het
Pax6 A G 2: 105,695,400 H376R possibly damaging Het
Pnkd C T 1: 74,351,782 R376C probably damaging Het
Pnpla8 T C 12: 44,295,913 F484S probably damaging Het
Psme4 T A 11: 30,832,573 H909Q probably benign Het
Rasip1 CGG CGGG 7: 45,632,396 probably null Het
Rbm47 A T 5: 66,025,052 Y413N probably damaging Het
Rnf123 A G 9: 108,052,439 probably null Het
Ruvbl1 T A 6: 88,484,430 M259K possibly damaging Het
Sohlh2 A G 3: 55,190,529 H134R probably benign Het
Sorbs2 A G 8: 45,795,293 D447G possibly damaging Het
Tank C T 2: 61,650,229 P370S probably benign Het
Tenm4 A G 7: 96,894,924 E2049G probably damaging Het
Tnik A G 3: 28,594,077 H426R possibly damaging Het
Trpm6 C A 19: 18,854,200 S1476R possibly damaging Het
Trpm7 G A 2: 126,840,783 Q389* probably null Het
Ttc28 G A 5: 111,285,229 R2043Q possibly damaging Het
Tymp A G 15: 89,376,307 S103P probably damaging Het
Usp40 C T 1: 87,967,179 probably null Het
Vmn1r202 T A 13: 22,501,807 N147Y probably damaging Het
Vmn2r89 T C 14: 51,452,231 S64P probably damaging Het
Vps13a A T 19: 16,749,856 D229E probably benign Het
Vps52 A G 17: 33,961,179 I354V probably benign Het
Zbtb8os T C 4: 129,341,764 F90L probably damaging Het
Zfp36l1 T C 12: 80,110,496 D37G possibly damaging Het
Zfp467 A G 6: 48,427,817 S109P unknown Het
Zzef1 T A 11: 72,837,212 C535S probably damaging Het
Other mutations in Cgn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00228:Cgn APN 3 94765548 missense probably benign 0.00
IGL00823:Cgn APN 3 94767209 missense probably damaging 1.00
IGL01349:Cgn APN 3 94767176 nonsense probably null
IGL01433:Cgn APN 3 94779459 missense probably damaging 0.99
IGL01467:Cgn APN 3 94779588 missense probably damaging 1.00
IGL01781:Cgn APN 3 94773205 missense probably benign
IGL01789:Cgn APN 3 94776218 missense possibly damaging 0.63
IGL01879:Cgn APN 3 94774364 nonsense probably null
IGL02805:Cgn APN 3 94774377 missense probably damaging 0.96
IGL02814:Cgn APN 3 94774240 missense probably benign 0.00
IGL02926:Cgn APN 3 94778016 missense probably benign 0.01
IGL03113:Cgn APN 3 94779234 missense probably benign
IGL03340:Cgn APN 3 94778095 intron probably benign
R0054:Cgn UTSW 3 94762592 missense possibly damaging 0.95
R0310:Cgn UTSW 3 94765653 missense possibly damaging 0.88
R0355:Cgn UTSW 3 94774932 missense probably benign
R0615:Cgn UTSW 3 94770714 unclassified probably benign
R0656:Cgn UTSW 3 94774894 unclassified probably benign
R1491:Cgn UTSW 3 94763228 missense probably damaging 1.00
R1509:Cgn UTSW 3 94774258 missense probably benign 0.00
R1794:Cgn UTSW 3 94762557 critical splice donor site probably null
R2113:Cgn UTSW 3 94779806 missense probably damaging 1.00
R3121:Cgn UTSW 3 94778482 splice site probably benign
R4655:Cgn UTSW 3 94779249 nonsense probably null
R4703:Cgn UTSW 3 94776095 utr 3 prime probably benign
R4715:Cgn UTSW 3 94779438 missense probably damaging 1.00
R4959:Cgn UTSW 3 94778254 missense probably benign 0.06
R4973:Cgn UTSW 3 94778254 missense probably benign 0.06
R4995:Cgn UTSW 3 94779936 missense probably damaging 1.00
R5011:Cgn UTSW 3 94776145 missense probably null 1.00
R5329:Cgn UTSW 3 94779990 start codon destroyed probably null 0.02
R5524:Cgn UTSW 3 94779989 start codon destroyed probably null 0.56
R5695:Cgn UTSW 3 94773635 missense probably benign 0.00
R5839:Cgn UTSW 3 94774393 missense probably damaging 0.99
R5987:Cgn UTSW 3 94779522 missense probably benign 0.00
R6146:Cgn UTSW 3 94767125 missense possibly damaging 0.94
R6311:Cgn UTSW 3 94778176 intron probably benign
R6948:Cgn UTSW 3 94773221 missense probably benign 0.06
R7038:Cgn UTSW 3 94763085 missense possibly damaging 0.80
R7231:Cgn UTSW 3 94773192 missense probably damaging 0.99
R7251:Cgn UTSW 3 94776199 missense possibly damaging 0.82
R7408:Cgn UTSW 3 94763055 nonsense probably null
R7828:Cgn UTSW 3 94769179 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- GGTTCTTTGAACTGTCCACATGG -3'
(R):5'- AGCACATCTGATGAGGAGCC -3'

Sequencing Primer
(F):5'- GAACTGTCCACATGGTTGTCATAC -3'
(R):5'- TGGAAAACTGATCCGTTCCCAGTC -3'
Posted On2015-10-21