Incidental Mutation 'R4714:Ruvbl1'
ID353434
Institutional Source Beutler Lab
Gene Symbol Ruvbl1
Ensembl Gene ENSMUSG00000030079
Gene NameRuvB-like protein 1
SynonymsTip49a, 2510009G06Rik, Pontin52
MMRRC Submission 041956-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.968) question?
Stock #R4714 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location88465409-88497572 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 88484430 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 259 (M259K)
Ref Sequence ENSEMBL: ENSMUSP00000032165 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032165] [ENSMUST00000129035]
Predicted Effect possibly damaging
Transcript: ENSMUST00000032165
AA Change: M259K

PolyPhen 2 Score 0.608 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000032165
Gene: ENSMUSG00000030079
AA Change: M259K

DomainStartEndE-ValueType
AAA 62 365 1.51e-11 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000129035
SMART Domains Protein: ENSMUSP00000117925
Gene: ENSMUSG00000030079

DomainStartEndE-ValueType
Pfam:AAA_19 1 77 1.3e-7 PFAM
Pfam:TIP49 1 134 2.7e-60 PFAM
Pfam:RuvB_N 2 52 5.5e-7 PFAM
Pfam:AAA 6 80 1.5e-10 PFAM
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that has both DNA-dependent ATPase and DNA helicase activities and belongs to the ATPases associated with diverse cellular activities (AAA+) protein family. The encoded protein associates with several multisubunit transcriptional complexes and with protein complexes involved in both ATP-dependent remodeling and histone modification. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Jan 2016]
PHENOTYPE: Mice homozygous for a null allele show impaired proliferation of the pluripotent inner mass cells and embryonic lethality before implantation. Conditional ablation of this gene in hematopoietic tissues leads to bone marrow failure involving apoptotic loss of hematopoietic stem cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700049A03Rik G T 12: 71,164,546 E685* probably null Het
2700049A03Rik A T 12: 71,164,547 E685V possibly damaging Het
4930486L24Rik A G 13: 60,844,318 V298A probably damaging Het
Abca12 A G 1: 71,321,450 V534A probably benign Het
Abcb4 A G 5: 8,930,906 probably null Het
Adam30 A T 3: 98,162,854 S668C probably damaging Het
Ap1g1 T A 8: 109,829,620 V196D probably damaging Het
Atp11b G A 3: 35,834,394 V738I probably benign Het
Cast C T 13: 74,798,715 V27I probably damaging Het
Cfap54 A G 10: 92,815,918 I3090T probably benign Het
Cgn C A 3: 94,779,438 G185W probably damaging Het
Champ1 T C 8: 13,878,063 Y74H probably damaging Het
Cpm T C 10: 117,675,985 I278T probably damaging Het
Dcaf15 T C 8: 84,102,216 T141A probably benign Het
Dcun1d1 C T 3: 35,895,670 V244M probably damaging Het
Defb8 A G 8: 19,447,559 L12P probably damaging Het
Dlg1 A T 16: 31,790,261 I225F probably damaging Het
Dync2h1 G T 9: 7,118,932 H2178N possibly damaging Het
Enam A G 5: 88,503,536 E893G probably damaging Het
Flt4 T A 11: 49,627,207 L358Q probably damaging Het
Frmpd1 A G 4: 45,284,785 Q1202R probably benign Het
Ghr T A 15: 3,320,397 D433V possibly damaging Het
Grm7 G A 6: 111,080,422 D328N possibly damaging Het
Haus4 T C 14: 54,542,120 D349G probably benign Het
Helz T C 11: 107,626,716 probably null Het
Hif3a A G 7: 17,056,271 L69P probably damaging Het
Ifit1 A G 19: 34,648,163 E233G probably damaging Het
Kcnc2 T C 10: 112,455,828 F307S possibly damaging Het
Lrp1b A T 2: 41,110,759 V2151E possibly damaging Het
Lrp5 T C 19: 3,659,454 N92S probably damaging Het
Metrnl C T 11: 121,716,013 A216V probably damaging Het
Msh2 A G 17: 87,718,789 T732A probably damaging Het
Necab2 T C 8: 119,467,595 L270P probably damaging Het
Noc3l T C 19: 38,815,713 K74E probably benign Het
Oas2 A T 5: 120,733,472 L702Q probably damaging Het
Olfr136 A C 17: 38,335,840 I228L possibly damaging Het
Olfr3 A T 2: 36,813,035 I19N probably benign Het
Olfr728 A G 14: 50,139,979 I220T possibly damaging Het
Olfr731 C A 14: 50,238,367 V173L possibly damaging Het
Olfr812 A T 10: 129,842,945 N32K probably damaging Het
Pax6 A G 2: 105,695,400 H376R possibly damaging Het
Pnkd C T 1: 74,351,782 R376C probably damaging Het
Pnpla8 T C 12: 44,295,913 F484S probably damaging Het
Psme4 T A 11: 30,832,573 H909Q probably benign Het
Rasip1 CGG CGGG 7: 45,632,396 probably null Het
Rbm47 A T 5: 66,025,052 Y413N probably damaging Het
Rnf123 A G 9: 108,052,439 probably null Het
Sohlh2 A G 3: 55,190,529 H134R probably benign Het
Sorbs2 A G 8: 45,795,293 D447G possibly damaging Het
Tank C T 2: 61,650,229 P370S probably benign Het
Tenm4 A G 7: 96,894,924 E2049G probably damaging Het
Tnik A G 3: 28,594,077 H426R possibly damaging Het
Trpm6 C A 19: 18,854,200 S1476R possibly damaging Het
Trpm7 G A 2: 126,840,783 Q389* probably null Het
Ttc28 G A 5: 111,285,229 R2043Q possibly damaging Het
Tymp A G 15: 89,376,307 S103P probably damaging Het
Usp40 C T 1: 87,967,179 probably null Het
Vmn1r202 T A 13: 22,501,807 N147Y probably damaging Het
Vmn2r89 T C 14: 51,452,231 S64P probably damaging Het
Vps13a A T 19: 16,749,856 D229E probably benign Het
Vps52 A G 17: 33,961,179 I354V probably benign Het
Zbtb8os T C 4: 129,341,764 F90L probably damaging Het
Zfp36l1 T C 12: 80,110,496 D37G possibly damaging Het
Zfp467 A G 6: 48,427,817 S109P unknown Het
Zzef1 T A 11: 72,837,212 C535S probably damaging Het
Other mutations in Ruvbl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00230:Ruvbl1 APN 6 88484403 unclassified probably benign
IGL00473:Ruvbl1 APN 6 88491568 missense probably damaging 1.00
IGL01768:Ruvbl1 APN 6 88497271 missense probably benign
IGL03354:Ruvbl1 APN 6 88479215 nonsense probably null
R0106:Ruvbl1 UTSW 6 88473200 missense probably damaging 1.00
R0106:Ruvbl1 UTSW 6 88473200 missense probably damaging 1.00
R0145:Ruvbl1 UTSW 6 88484459 missense possibly damaging 0.90
R0676:Ruvbl1 UTSW 6 88473200 missense probably damaging 1.00
R1448:Ruvbl1 UTSW 6 88467569 missense probably benign 0.05
R1561:Ruvbl1 UTSW 6 88479154 missense probably damaging 1.00
R1574:Ruvbl1 UTSW 6 88479154 missense probably damaging 1.00
R1623:Ruvbl1 UTSW 6 88485770 missense probably damaging 1.00
R2113:Ruvbl1 UTSW 6 88483021 missense probably damaging 0.99
R2372:Ruvbl1 UTSW 6 88485797 missense possibly damaging 0.53
R2397:Ruvbl1 UTSW 6 88465552 missense possibly damaging 0.71
R2894:Ruvbl1 UTSW 6 88479132 missense possibly damaging 0.87
R4037:Ruvbl1 UTSW 6 88473135 missense probably damaging 1.00
R4604:Ruvbl1 UTSW 6 88485905 missense probably benign
R4684:Ruvbl1 UTSW 6 88491599 missense probably benign 0.00
R4835:Ruvbl1 UTSW 6 88497229 missense possibly damaging 0.69
R4939:Ruvbl1 UTSW 6 88483039 unclassified probably null
R5114:Ruvbl1 UTSW 6 88497290 missense probably benign 0.41
R5126:Ruvbl1 UTSW 6 88485901 missense probably benign 0.13
R5296:Ruvbl1 UTSW 6 88485908 missense probably damaging 0.99
R5507:Ruvbl1 UTSW 6 88467600 missense probably benign 0.00
R5559:Ruvbl1 UTSW 6 88473096 missense possibly damaging 0.90
R5819:Ruvbl1 UTSW 6 88483115 splice site probably null
R6048:Ruvbl1 UTSW 6 88482991 missense possibly damaging 0.90
R6155:Ruvbl1 UTSW 6 88479125 critical splice acceptor site probably null
R6564:Ruvbl1 UTSW 6 88479226 missense possibly damaging 0.93
R6704:Ruvbl1 UTSW 6 88479205 missense probably benign 0.06
R7681:Ruvbl1 UTSW 6 88467653 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- GCCTGTGAAGTTCCTCTGTG -3'
(R):5'- AGCTGTGATCTCAGAGGAGG -3'

Sequencing Primer
(F):5'- GTCTACAGTGCAAGTTCATGGAC -3'
(R):5'- TCTCAGAGGAGGGAAGACACCATC -3'
Posted On2015-10-21