Mutagenetix > Incidental Mutation

Incidental Mutation 'R4714:Cfap54'

353452

Institutional Source

Beutler Lab

Gene Symbol

Cfap54

Ensembl Gene

ENSMUSG00000020014

Gene Name

cilia and flagella associated protein 54

Synonyms

LOC380653, Gm872, 4930485B16Rik

MMRRC Submission

041956-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.095) question?

Stock #

R4714 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

92775619-93081618 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 92815918 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Threonine at position 3090 (I3090T)

Ref Sequence

ENSEMBL: ENSMUSP00000148636 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000168110] [ENSMUST00000212902]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000163209
AA Change: I136T

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

Predicted Effect

unknown
Transcript: ENSMUST00000168110
AA Change: I3025T

SMART Domains

Protein: ENSMUSP00000129517
Gene: ENSMUSG00000020014
AA Change: I3025T

Domain	Start	End	E-Value	Type
low complexity region	3	37	N/A	INTRINSIC
low complexity region	39	48	N/A	INTRINSIC
Pfam:DUF4486	104	642	1.1e-269	PFAM
low complexity region	842	851	N/A	INTRINSIC
low complexity region	902	915	N/A	INTRINSIC
Blast:FN3	916	1002	4e-48	BLAST
low complexity region	1409	1426	N/A	INTRINSIC
low complexity region	1974	1984	N/A	INTRINSIC
low complexity region	2354	2370	N/A	INTRINSIC
low complexity region	2500	2513	N/A	INTRINSIC
low complexity region	2605	2616	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000212902
AA Change: I3090T

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)

Coding Region Coverage

1x: 99.1%
3x: 98.5%
10x: 97.0%
20x: 94.7%

Validation Efficiency

MGI Phenotype

PHENOTYPE: Homozygous inactivation of this gene causes background-dependent lethality and hydroencephaly, male sterility associated with defects in spermiogenesis, and impaired mucociliary clearance. Airway epithelial cilia show structural defects and a decrease in ciliary beat frequency and cilia-driven flow. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 65 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2700049A03Rik	G	T	12: 71,164,546	E685*	probably null	Het
2700049A03Rik	A	T	12: 71,164,547	E685V	possibly damaging	Het
4930486L24Rik	A	G	13: 60,844,318	V298A	probably damaging	Het
Abca12	A	G	1: 71,321,450	V534A	probably benign	Het
Abcb4	A	G	5: 8,930,906		probably null	Het
Adam30	A	T	3: 98,162,854	S668C	probably damaging	Het
Ap1g1	T	A	8: 109,829,620	V196D	probably damaging	Het
Atp11b	G	A	3: 35,834,394	V738I	probably benign	Het
Cast	C	T	13: 74,798,715	V27I	probably damaging	Het
Cgn	C	A	3: 94,779,438	G185W	probably damaging	Het
Champ1	T	C	8: 13,878,063	Y74H	probably damaging	Het
Cpm	T	C	10: 117,675,985	I278T	probably damaging	Het
Dcaf15	T	C	8: 84,102,216	T141A	probably benign	Het
Dcun1d1	C	T	3: 35,895,670	V244M	probably damaging	Het
Defb8	A	G	8: 19,447,559	L12P	probably damaging	Het
Dlg1	A	T	16: 31,790,261	I225F	probably damaging	Het
Dync2h1	G	T	9: 7,118,932	H2178N	possibly damaging	Het
Enam	A	G	5: 88,503,536	E893G	probably damaging	Het
Flt4	T	A	11: 49,627,207	L358Q	probably damaging	Het
Frmpd1	A	G	4: 45,284,785	Q1202R	probably benign	Het
Ghr	T	A	15: 3,320,397	D433V	possibly damaging	Het
Grm7	G	A	6: 111,080,422	D328N	possibly damaging	Het
Haus4	T	C	14: 54,542,120	D349G	probably benign	Het
Helz	T	C	11: 107,626,716		probably null	Het
Hif3a	A	G	7: 17,056,271	L69P	probably damaging	Het
Ifit1	A	G	19: 34,648,163	E233G	probably damaging	Het
Kcnc2	T	C	10: 112,455,828	F307S	possibly damaging	Het
Lrp1b	A	T	2: 41,110,759	V2151E	possibly damaging	Het
Lrp5	T	C	19: 3,659,454	N92S	probably damaging	Het
Metrnl	C	T	11: 121,716,013	A216V	probably damaging	Het
Msh2	A	G	17: 87,718,789	T732A	probably damaging	Het
Necab2	T	C	8: 119,467,595	L270P	probably damaging	Het
Noc3l	T	C	19: 38,815,713	K74E	probably benign	Het
Oas2	A	T	5: 120,733,472	L702Q	probably damaging	Het
Olfr136	A	C	17: 38,335,840	I228L	possibly damaging	Het
Olfr3	A	T	2: 36,813,035	I19N	probably benign	Het
Olfr728	A	G	14: 50,139,979	I220T	possibly damaging	Het
Olfr731	C	A	14: 50,238,367	V173L	possibly damaging	Het
Olfr812	A	T	10: 129,842,945	N32K	probably damaging	Het
Pax6	A	G	2: 105,695,400	H376R	possibly damaging	Het
Pnkd	C	T	1: 74,351,782	R376C	probably damaging	Het
Pnpla8	T	C	12: 44,295,913	F484S	probably damaging	Het
Psme4	T	A	11: 30,832,573	H909Q	probably benign	Het
Rasip1	CGG	CGGG	7: 45,632,396		probably null	Het
Rbm47	A	T	5: 66,025,052	Y413N	probably damaging	Het
Rnf123	A	G	9: 108,052,439		probably null	Het
Ruvbl1	T	A	6: 88,484,430	M259K	possibly damaging	Het
Sohlh2	A	G	3: 55,190,529	H134R	probably benign	Het
Sorbs2	A	G	8: 45,795,293	D447G	possibly damaging	Het
Tank	C	T	2: 61,650,229	P370S	probably benign	Het
Tenm4	A	G	7: 96,894,924	E2049G	probably damaging	Het
Tnik	A	G	3: 28,594,077	H426R	possibly damaging	Het
Trpm6	C	A	19: 18,854,200	S1476R	possibly damaging	Het
Trpm7	G	A	2: 126,840,783	Q389*	probably null	Het
Ttc28	G	A	5: 111,285,229	R2043Q	possibly damaging	Het
Tymp	A	G	15: 89,376,307	S103P	probably damaging	Het
Usp40	C	T	1: 87,967,179		probably null	Het
Vmn1r202	T	A	13: 22,501,807	N147Y	probably damaging	Het
Vmn2r89	T	C	14: 51,452,231	S64P	probably damaging	Het
Vps13a	A	T	19: 16,749,856	D229E	probably benign	Het
Vps52	A	G	17: 33,961,179	I354V	probably benign	Het
Zbtb8os	T	C	4: 129,341,764	F90L	probably damaging	Het
Zfp36l1	T	C	12: 80,110,496	D37G	possibly damaging	Het
Zfp467	A	G	6: 48,427,817	S109P	unknown	Het
Zzef1	T	A	11: 72,837,212	C535S	probably damaging	Het

Other mutations in Cfap54

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01329:Cfap54	APN	10	93081523	missense	unknown
IGL02034:Cfap54	APN	10	93061485	missense	probably damaging	0.99
IGL02082:Cfap54	APN	10	93081458	missense	unknown
IGL02434:Cfap54	APN	10	93066754	missense	probably benign	0.20
R0011:Cfap54	UTSW	10	93065225	missense	probably damaging	0.97
R0011:Cfap54	UTSW	10	93065225	missense	probably damaging	0.97
R0032:Cfap54	UTSW	10	92932697	missense	probably benign	0.04
R0032:Cfap54	UTSW	10	92932697	missense	probably benign	0.04
R0040:Cfap54	UTSW	10	92977039	missense	probably benign	0.33
R0044:Cfap54	UTSW	10	93035433	missense	probably null	0.46
R0086:Cfap54	UTSW	10	93028594	missense	possibly damaging	0.86
R0104:Cfap54	UTSW	10	93028652	missense	probably damaging	1.00
R0194:Cfap54	UTSW	10	93034662	unclassified	probably benign
R0234:Cfap54	UTSW	10	92899160	nonsense	probably null
R0308:Cfap54	UTSW	10	92885364	missense	unknown
R0332:Cfap54	UTSW	10	93035457	missense	probably damaging	1.00
R0409:Cfap54	UTSW	10	92776213	missense	probably benign	0.00
R0433:Cfap54	UTSW	10	92979080	splice site	probably benign
R0436:Cfap54	UTSW	10	93038975	missense	possibly damaging	0.95
R0463:Cfap54	UTSW	10	92874943	critical splice donor site	probably null
R0523:Cfap54	UTSW	10	92908883	utr 3 prime	probably benign
R0551:Cfap54	UTSW	10	93025122	missense	probably benign	0.35
R0595:Cfap54	UTSW	10	92884736	missense	unknown
R0617:Cfap54	UTSW	10	92829650	splice site	probably benign
R0632:Cfap54	UTSW	10	92885096	missense	unknown
R0730:Cfap54	UTSW	10	93034737	missense	probably benign	0.05
R0786:Cfap54	UTSW	10	92967535	missense	possibly damaging	0.72
R0883:Cfap54	UTSW	10	92870669	missense	unknown
R1004:Cfap54	UTSW	10	93066696	splice site	probably benign
R1033:Cfap54	UTSW	10	92839449	missense	probably benign	0.07
R1168:Cfap54	UTSW	10	92937920	missense	probably damaging	0.99
R1186:Cfap54	UTSW	10	92875994	missense	unknown
R1429:Cfap54	UTSW	10	92821038	missense	probably benign	0.01
R1443:Cfap54	UTSW	10	92932721	missense	probably damaging	1.00
R1467:Cfap54	UTSW	10	92969763	missense	probably benign	0.01
R1557:Cfap54	UTSW	10	92984227	missense	possibly damaging	0.68
R1687:Cfap54	UTSW	10	92932640	missense	probably damaging	1.00
R1690:Cfap54	UTSW	10	93035442	missense	possibly damaging	0.95
R1711:Cfap54	UTSW	10	93011020	missense	probably damaging	1.00
R1756:Cfap54	UTSW	10	93048061	missense	probably damaging	1.00
R1769:Cfap54	UTSW	10	92904263	critical splice donor site	probably null
R1835:Cfap54	UTSW	10	92962375	missense	probably benign	0.35
R1889:Cfap54	UTSW	10	93034710	missense	possibly damaging	0.94
R1915:Cfap54	UTSW	10	92884702	missense	unknown
R1958:Cfap54	UTSW	10	92997342	missense	probably benign	0.18
R2005:Cfap54	UTSW	10	92884768	missense	unknown
R2018:Cfap54	UTSW	10	93016604	missense	probably benign	0.00
R2045:Cfap54	UTSW	10	93038809	splice site	probably null
R2059:Cfap54	UTSW	10	92942979	unclassified	probably benign
R2100:Cfap54	UTSW	10	93001937	missense	possibly damaging	0.84
R2110:Cfap54	UTSW	10	92886367	missense	unknown
R2392:Cfap54	UTSW	10	93025011	critical splice donor site	probably null
R2508:Cfap54	UTSW	10	92997374	missense	possibly damaging	0.72
R2852:Cfap54	UTSW	10	92940155	missense	probably damaging	1.00
R2857:Cfap54	UTSW	10	93045282	missense	probably damaging	0.99
R2871:Cfap54	UTSW	10	92921419	missense	possibly damaging	0.86
R2871:Cfap54	UTSW	10	92921419	missense	possibly damaging	0.86
R3107:Cfap54	UTSW	10	92994683	missense	probably benign	0.04
R3108:Cfap54	UTSW	10	92994683	missense	probably benign	0.04
R3157:Cfap54	UTSW	10	92999056	missense	probably benign	0.03
R3158:Cfap54	UTSW	10	92999056	missense	probably benign	0.03
R3159:Cfap54	UTSW	10	92999056	missense	probably benign	0.03
R3161:Cfap54	UTSW	10	93045278	missense	probably damaging	1.00
R3162:Cfap54	UTSW	10	93045278	missense	probably damaging	1.00
R3162:Cfap54	UTSW	10	93045278	missense	probably damaging	1.00
R3508:Cfap54	UTSW	10	92885424	missense	unknown
R3730:Cfap54	UTSW	10	93011473	nonsense	probably null
R3770:Cfap54	UTSW	10	92878536	missense	unknown
R3776:Cfap54	UTSW	10	93045100	missense	probably damaging	1.00
R3778:Cfap54	UTSW	10	92904344	utr 3 prime	probably benign
R3795:Cfap54	UTSW	10	92942873	unclassified	probably benign
R3834:Cfap54	UTSW	10	92801123	splice site	probably benign
R3891:Cfap54	UTSW	10	93038846	missense	possibly damaging	0.87
R3932:Cfap54	UTSW	10	92829757	missense	probably benign	0.03
R3973:Cfap54	UTSW	10	92839471	missense	possibly damaging	0.95
R3974:Cfap54	UTSW	10	92839471	missense	possibly damaging	0.95
R3976:Cfap54	UTSW	10	92839471	missense	possibly damaging	0.95
R3978:Cfap54	UTSW	10	92962412	missense	probably benign	0.01
R4190:Cfap54	UTSW	10	92885023	missense	unknown
R4389:Cfap54	UTSW	10	92967500	missense	probably benign	0.37
R4542:Cfap54	UTSW	10	93025129	missense	probably benign	0.12
R4564:Cfap54	UTSW	10	92839540	unclassified	probably benign
R4576:Cfap54	UTSW	10	93043228	critical splice donor site	probably null
R4620:Cfap54	UTSW	10	92969757	missense	probably benign	0.01
R4762:Cfap54	UTSW	10	93061453	splice site	probably null
R4776:Cfap54	UTSW	10	92972694	missense	possibly damaging	0.96
R4819:Cfap54	UTSW	10	92836477	nonsense	probably null
R4827:Cfap54	UTSW	10	92902075	utr 3 prime	probably benign
R4832:Cfap54	UTSW	10	92967528	missense	probably benign	0.01
R4965:Cfap54	UTSW	10	93066799	missense	probably benign	0.23
R5001:Cfap54	UTSW	10	92964534	missense	probably benign	0.01
R5060:Cfap54	UTSW	10	93039151	missense	probably damaging	1.00
R5067:Cfap54	UTSW	10	93066766	missense	probably benign	0.17
R5069:Cfap54	UTSW	10	92937774	missense	probably benign
R5094:Cfap54	UTSW	10	92898999	utr 3 prime	probably benign
R5109:Cfap54	UTSW	10	92937891	missense	probably benign	0.03
R5127:Cfap54	UTSW	10	92886387	splice site	probably null
R5143:Cfap54	UTSW	10	93029158	missense	possibly damaging	0.73
R5147:Cfap54	UTSW	10	92937838	missense	probably benign	0.00
R5158:Cfap54	UTSW	10	93065197	missense	probably damaging	1.00
R5256:Cfap54	UTSW	10	92935091	nonsense	probably null
R5256:Cfap54	UTSW	10	93045023	splice site	probably null
R5266:Cfap54	UTSW	10	92815902	missense	probably benign	0.16
R5304:Cfap54	UTSW	10	92821106	missense	probably damaging	0.97
R5369:Cfap54	UTSW	10	93061257	intron	probably benign
R5406:Cfap54	UTSW	10	93001858	missense	probably benign	0.33
R5471:Cfap54	UTSW	10	93028660	missense	probably damaging	1.00
R5485:Cfap54	UTSW	10	93029117	missense	probably damaging	1.00
R5540:Cfap54	UTSW	10	92972608	missense	possibly damaging	0.85
R5586:Cfap54	UTSW	10	92972611	nonsense	probably null
R5614:Cfap54	UTSW	10	93045049	missense	probably damaging	1.00
R5634:Cfap54	UTSW	10	92904263	critical splice donor site	probably benign
R5680:Cfap54	UTSW	10	92979017	nonsense	probably null
R5797:Cfap54	UTSW	10	92967576	missense	probably benign	0.11
R5859:Cfap54	UTSW	10	93016524	nonsense	probably null
R5878:Cfap54	UTSW	10	92964561	missense	probably benign	0.01
R5910:Cfap54	UTSW	10	93065181	missense	probably damaging	0.99
R5936:Cfap54	UTSW	10	92962412	missense	probably benign	0.01
R5994:Cfap54	UTSW	10	93039081	missense	probably damaging	0.99
R6080:Cfap54	UTSW	10	93045335	missense	possibly damaging	0.64
R6268:Cfap54	UTSW	10	93038909	missense	probably damaging	1.00
R6296:Cfap54	UTSW	10	93066846	missense	probably damaging	1.00
R6409:Cfap54	UTSW	10	92967492	missense	probably benign	0.04
R6545:Cfap54	UTSW	10	92836457	missense	probably benign	0.31
R6570:Cfap54	UTSW	10	92815958	missense	unknown
R6597:Cfap54	UTSW	10	92999040	missense	possibly damaging	0.85
R6702:Cfap54	UTSW	10	92868734	missense	unknown
R6703:Cfap54	UTSW	10	92868734	missense	unknown
R6720:Cfap54	UTSW	10	92821119	missense	probably benign	0.07
R6841:Cfap54	UTSW	10	92875015	missense	unknown
R6910:Cfap54	UTSW	10	92836512	missense	probably benign	0.29
R6953:Cfap54	UTSW	10	92994678	missense	probably benign	0.19
R7009:Cfap54	UTSW	10	92875019	missense	unknown
R7129:Cfap54	UTSW	10	93016571	missense	probably benign	0.06
R7131:Cfap54	UTSW	10	92821104	missense	probably benign	0.03
R7171:Cfap54	UTSW	10	92776210	missense	probably damaging	0.99
R7189:Cfap54	UTSW	10	92937728	missense	unknown
R7225:Cfap54	UTSW	10	92904374	missense	unknown
R7270:Cfap54	UTSW	10	92839458	missense	probably benign	0.03
R7323:Cfap54	UTSW	10	92801138	missense	probably benign	0.00
R7380:Cfap54	UTSW	10	93047978	missense	probably damaging	1.00
R7395:Cfap54	UTSW	10	92884703	missense	unknown
R7411:Cfap54	UTSW	10	92868755	missense	unknown
R7503:Cfap54	UTSW	10	92887436	splice site	probably null
R7622:Cfap54	UTSW	10	92956944	missense	unknown
R7679:Cfap54	UTSW	10	92967512	missense	probably benign	0.01
R7776:Cfap54	UTSW	10	92868741	missense	unknown
R7844:Cfap54	UTSW	10	92902058	missense	unknown
R7980:Cfap54	UTSW	10	92982060	missense	possibly damaging	0.95
R7988:Cfap54	UTSW	10	92902079	missense	unknown
R8101:Cfap54	UTSW	10	92884796	missense	unknown
R8119:Cfap54	UTSW	10	92868810	missense	unknown
R8134:Cfap54	UTSW	10	92878516	missense	unknown
R8168:Cfap54	UTSW	10	92908877	missense	unknown
R8179:Cfap54	UTSW	10	92997316	missense	possibly damaging	0.68
R8392:Cfap54	UTSW	10	92962417	missense	unknown
R8436:Cfap54	UTSW	10	92964536	missense	unknown
R8505:Cfap54	UTSW	10	92978993	missense	probably benign	0.03
R8671:Cfap54	UTSW	10	92955072	missense	unknown
R8716:Cfap54	UTSW	10	92964632	missense	probably benign	0.00
R8816:Cfap54	UTSW	10	92878592	missense	unknown
R8822:Cfap54	UTSW	10	93039141	missense	probably benign	0.09
R8827:Cfap54	UTSW	10	92938248	missense	unknown
R8920:Cfap54	UTSW	10	92940337	critical splice acceptor site	probably null
R8924:Cfap54	UTSW	10	93001823	missense	probably damaging	0.99
R8954:Cfap54	UTSW	10	93043393	missense	probably damaging	1.00
R8963:Cfap54	UTSW	10	93028700	nonsense	probably null
R9010:Cfap54	UTSW	10	92899059	missense	unknown
R9017:Cfap54	UTSW	10	92816021	missense	probably benign	0.07
R9093:Cfap54	UTSW	10	92815908	missense	probably benign	0.03
R9095:Cfap54	UTSW	10	93011020	missense	probably damaging	1.00
R9142:Cfap54	UTSW	10	92984235	missense	possibly damaging	0.87
R9178:Cfap54	UTSW	10	92994717	missense	probably benign	0.10
R9196:Cfap54	UTSW	10	93037891	missense	probably benign	0.22
R9203:Cfap54	UTSW	10	93045128	missense	probably benign	0.30
R9258:Cfap54	UTSW	10	92935098	missense	unknown
R9275:Cfap54	UTSW	10	93039186	missense	possibly damaging	0.86
R9287:Cfap54	UTSW	10	92969703	missense	possibly damaging	0.50
R9289:Cfap54	UTSW	10	92821074	missense	possibly damaging	0.83
R9310:Cfap54	UTSW	10	92962315	missense	unknown
R9397:Cfap54	UTSW	10	92997285	missense	probably damaging	0.96
R9462:Cfap54	UTSW	10	92902058	missense	unknown
R9697:Cfap54	UTSW	10	92956989	missense	unknown
R9746:Cfap54	UTSW	10	92801219	missense	probably benign	0.03
R9755:Cfap54	UTSW	10	92921368	missense	unknown
X0022:Cfap54	UTSW	10	92878603	missense	unknown
X0022:Cfap54	UTSW	10	92932614	missense	probably damaging	1.00
X0027:Cfap54	UTSW	10	92878538	missense	unknown
X0027:Cfap54	UTSW	10	93001888	missense	possibly damaging	0.86
Z1177:Cfap54	UTSW	10	92979026	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GCGAATACACATGTATGCATATGAC -3'
(R):5'- TGGGGAATTCAGACACCTAACTC -3'

Sequencing Primer
(F):5'- TGACTTAGACCATATCTGGAAGCC -3'
(R):5'- TTATTGAGTCTAAAACCAGTACCCC -3'

Posted On

2015-10-21