Incidental Mutation 'R4714:Kcnc2'
ID353453
Institutional Source Beutler Lab
Gene Symbol Kcnc2
Ensembl Gene ENSMUSG00000035681
Gene Namepotassium voltage gated channel, Shaw-related subfamily, member 2
SynonymsKv3.2, KShIIIA
MMRRC Submission 041956-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4714 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location112271121-112467024 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 112455828 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Serine at position 307 (F307S)
Ref Sequence ENSEMBL: ENSMUSP00000089814 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000092175] [ENSMUST00000218445] [ENSMUST00000218827] [ENSMUST00000219301] [ENSMUST00000219607]
Predicted Effect possibly damaging
Transcript: ENSMUST00000092175
AA Change: F307S

PolyPhen 2 Score 0.821 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000089814
Gene: ENSMUSG00000035681
AA Change: F307S

DomainStartEndE-ValueType
BTB 8 163 2.53e-17 SMART
Pfam:Ion_trans 232 488 1e-46 PFAM
Pfam:Ion_trans_2 388 481 5.8e-13 PFAM
low complexity region 552 568 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000218445
Predicted Effect probably benign
Transcript: ENSMUST00000218827
Predicted Effect probably benign
Transcript: ENSMUST00000219301
AA Change: F307S

PolyPhen 2 Score 0.427 (Sensitivity: 0.89; Specificity: 0.90)
Predicted Effect probably benign
Transcript: ENSMUST00000219607
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The Shaker gene family of Drosophila encodes components of voltage-gated potassium channels and is comprised of four subfamilies. Based on sequence similarity, this gene is similar to one of these subfamilies, namely the Shaw subfamily. The protein encoded by this gene belongs to the delayed rectifier class of channel proteins and is an integral membrane protein that mediates the voltage-dependent potassium ion permeability of excitable membranes. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, May 2012]
PHENOTYPE: Mice homozygous for a knock-out allele display impaired fast spiking in cortical interneurons, distorted cortical rhythmic activity, enhanced susceptibility to seizures, increased anxiety in the open field, and abnormal sleep patterns. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700049A03Rik G T 12: 71,164,546 E685* probably null Het
2700049A03Rik A T 12: 71,164,547 E685V possibly damaging Het
4930486L24Rik A G 13: 60,844,318 V298A probably damaging Het
Abca12 A G 1: 71,321,450 V534A probably benign Het
Abcb4 A G 5: 8,930,906 probably null Het
Adam30 A T 3: 98,162,854 S668C probably damaging Het
Ap1g1 T A 8: 109,829,620 V196D probably damaging Het
Atp11b G A 3: 35,834,394 V738I probably benign Het
Cast C T 13: 74,798,715 V27I probably damaging Het
Cfap54 A G 10: 92,815,918 I3090T probably benign Het
Cgn C A 3: 94,779,438 G185W probably damaging Het
Champ1 T C 8: 13,878,063 Y74H probably damaging Het
Cpm T C 10: 117,675,985 I278T probably damaging Het
Dcaf15 T C 8: 84,102,216 T141A probably benign Het
Dcun1d1 C T 3: 35,895,670 V244M probably damaging Het
Defb8 A G 8: 19,447,559 L12P probably damaging Het
Dlg1 A T 16: 31,790,261 I225F probably damaging Het
Dync2h1 G T 9: 7,118,932 H2178N possibly damaging Het
Enam A G 5: 88,503,536 E893G probably damaging Het
Flt4 T A 11: 49,627,207 L358Q probably damaging Het
Frmpd1 A G 4: 45,284,785 Q1202R probably benign Het
Ghr T A 15: 3,320,397 D433V possibly damaging Het
Grm7 G A 6: 111,080,422 D328N possibly damaging Het
Haus4 T C 14: 54,542,120 D349G probably benign Het
Helz T C 11: 107,626,716 probably null Het
Hif3a A G 7: 17,056,271 L69P probably damaging Het
Ifit1 A G 19: 34,648,163 E233G probably damaging Het
Lrp1b A T 2: 41,110,759 V2151E possibly damaging Het
Lrp5 T C 19: 3,659,454 N92S probably damaging Het
Metrnl C T 11: 121,716,013 A216V probably damaging Het
Msh2 A G 17: 87,718,789 T732A probably damaging Het
Necab2 T C 8: 119,467,595 L270P probably damaging Het
Noc3l T C 19: 38,815,713 K74E probably benign Het
Oas2 A T 5: 120,733,472 L702Q probably damaging Het
Olfr136 A C 17: 38,335,840 I228L possibly damaging Het
Olfr3 A T 2: 36,813,035 I19N probably benign Het
Olfr728 A G 14: 50,139,979 I220T possibly damaging Het
Olfr731 C A 14: 50,238,367 V173L possibly damaging Het
Olfr812 A T 10: 129,842,945 N32K probably damaging Het
Pax6 A G 2: 105,695,400 H376R possibly damaging Het
Pnkd C T 1: 74,351,782 R376C probably damaging Het
Pnpla8 T C 12: 44,295,913 F484S probably damaging Het
Psme4 T A 11: 30,832,573 H909Q probably benign Het
Rasip1 CGG CGGG 7: 45,632,396 probably null Het
Rbm47 A T 5: 66,025,052 Y413N probably damaging Het
Rnf123 A G 9: 108,052,439 probably null Het
Ruvbl1 T A 6: 88,484,430 M259K possibly damaging Het
Sohlh2 A G 3: 55,190,529 H134R probably benign Het
Sorbs2 A G 8: 45,795,293 D447G possibly damaging Het
Tank C T 2: 61,650,229 P370S probably benign Het
Tenm4 A G 7: 96,894,924 E2049G probably damaging Het
Tnik A G 3: 28,594,077 H426R possibly damaging Het
Trpm6 C A 19: 18,854,200 S1476R possibly damaging Het
Trpm7 G A 2: 126,840,783 Q389* probably null Het
Ttc28 G A 5: 111,285,229 R2043Q possibly damaging Het
Tymp A G 15: 89,376,307 S103P probably damaging Het
Usp40 C T 1: 87,967,179 probably null Het
Vmn1r202 T A 13: 22,501,807 N147Y probably damaging Het
Vmn2r89 T C 14: 51,452,231 S64P probably damaging Het
Vps13a A T 19: 16,749,856 D229E probably benign Het
Vps52 A G 17: 33,961,179 I354V probably benign Het
Zbtb8os T C 4: 129,341,764 F90L probably damaging Het
Zfp36l1 T C 12: 80,110,496 D37G possibly damaging Het
Zfp467 A G 6: 48,427,817 S109P unknown Het
Zzef1 T A 11: 72,837,212 C535S probably damaging Het
Other mutations in Kcnc2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00595:Kcnc2 APN 10 112461988 missense probably damaging 0.99
IGL00595:Kcnc2 APN 10 112461987 missense probably benign 0.04
IGL01646:Kcnc2 APN 10 112272406 critical splice donor site probably null
IGL01950:Kcnc2 APN 10 112462075 intron probably benign
IGL02036:Kcnc2 APN 10 112455926 missense possibly damaging 0.94
IGL02164:Kcnc2 APN 10 112455685 missense possibly damaging 0.92
IGL02447:Kcnc2 APN 10 112455946 missense probably damaging 1.00
IGL03087:Kcnc2 APN 10 112455747 missense probably benign 0.19
IGL03385:Kcnc2 APN 10 112455786 missense probably damaging 1.00
R0133:Kcnc2 UTSW 10 112458597 missense probably damaging 1.00
R1444:Kcnc2 UTSW 10 112455601 unclassified probably benign
R1474:Kcnc2 UTSW 10 112456400 missense probably damaging 1.00
R2221:Kcnc2 UTSW 10 112456526 missense probably damaging 1.00
R4504:Kcnc2 UTSW 10 112455794 missense probably damaging 1.00
R4935:Kcnc2 UTSW 10 112272228 missense probably benign 0.00
R6168:Kcnc2 UTSW 10 112455756 missense probably benign 0.13
R6338:Kcnc2 UTSW 10 112271856 missense probably benign 0.04
R6375:Kcnc2 UTSW 10 112463189 missense possibly damaging 0.92
R6511:Kcnc2 UTSW 10 112462067 intron probably benign
R6516:Kcnc2 UTSW 10 112462000 missense probably benign 0.00
R6556:Kcnc2 UTSW 10 112271856 missense probably benign 0.04
R6609:Kcnc2 UTSW 10 112271856 missense probably benign 0.04
R6610:Kcnc2 UTSW 10 112271856 missense probably benign 0.04
R6612:Kcnc2 UTSW 10 112271856 missense probably benign 0.04
R6837:Kcnc2 UTSW 10 112458502 missense probably damaging 0.96
R7151:Kcnc2 UTSW 10 112458509 missense possibly damaging 0.46
R7715:Kcnc2 UTSW 10 112271940 nonsense probably null
Predicted Primers PCR Primer
(F):5'- CATCACAACCTTTTGCCTGGAG -3'
(R):5'- AAGAGTATGTCCGAGCACCCTC -3'

Sequencing Primer
(F):5'- CCTTTTGCCTGGAGACACATGAAG -3'
(R):5'- CTCAGACCTACGAAATGGCGG -3'
Posted On2015-10-21