Incidental Mutation 'R4714:Or6c216'
ID 353455
Institutional Source Beutler Lab
Gene Symbol Or6c216
Ensembl Gene ENSMUSG00000049052
Gene Name olfactory receptor family 6 subfamily C member 216
Synonyms GA_x6K02T2PULF-11521598-11520666, Olfr812, MOR110-1
MMRRC Submission 041956-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.050) question?
Stock # R4714 (G1)
Quality Score 225
Status Not validated
Chromosome 10
Chromosomal Location 129677977-129678909 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 129678814 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Asparagine to Lysine at position 32 (N32K)
Ref Sequence ENSEMBL: ENSMUSP00000145482 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057775] [ENSMUST00000203571] [ENSMUST00000205013]
AlphaFold Q8VG64
Predicted Effect probably damaging
Transcript: ENSMUST00000057775
AA Change: N32K

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000053359
Gene: ENSMUSG00000049052
AA Change: N32K

DomainStartEndE-ValueType
Pfam:7tm_4 29 306 2.3e-50 PFAM
Pfam:7tm_1 39 288 9.5e-25 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000203571
AA Change: N32K

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000145284
Gene: ENSMUSG00000049052
AA Change: N32K

DomainStartEndE-ValueType
Pfam:7tm_4 29 306 2.3e-50 PFAM
Pfam:7tm_1 39 288 9.5e-25 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000205013
AA Change: N32K

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000145482
Gene: ENSMUSG00000049052
AA Change: N32K

DomainStartEndE-ValueType
Pfam:7tm_4 29 307 1.3e-44 PFAM
Pfam:7tm_1 39 288 4.1e-23 PFAM
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.7%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700049A03Rik G T 12: 71,211,320 (GRCm39) E685* probably null Het
2700049A03Rik A T 12: 71,211,321 (GRCm39) E685V possibly damaging Het
4930486L24Rik A G 13: 60,992,132 (GRCm39) V298A probably damaging Het
Abca12 A G 1: 71,360,609 (GRCm39) V534A probably benign Het
Abcb4 A G 5: 8,980,906 (GRCm39) probably null Het
Adam30 A T 3: 98,070,170 (GRCm39) S668C probably damaging Het
Ap1g1 T A 8: 110,556,252 (GRCm39) V196D probably damaging Het
Atp11b G A 3: 35,888,543 (GRCm39) V738I probably benign Het
Cast C T 13: 74,946,834 (GRCm39) V27I probably damaging Het
Cfap54 A G 10: 92,651,780 (GRCm39) I3090T probably benign Het
Cgn C A 3: 94,686,748 (GRCm39) G185W probably damaging Het
Champ1 T C 8: 13,928,063 (GRCm39) Y74H probably damaging Het
Cpm T C 10: 117,511,890 (GRCm39) I278T probably damaging Het
Dcaf15 T C 8: 84,828,845 (GRCm39) T141A probably benign Het
Dcun1d1 C T 3: 35,949,819 (GRCm39) V244M probably damaging Het
Defb8 A G 8: 19,497,575 (GRCm39) L12P probably damaging Het
Dlg1 A T 16: 31,609,079 (GRCm39) I225F probably damaging Het
Dync2h1 G T 9: 7,118,932 (GRCm39) H2178N possibly damaging Het
Enam A G 5: 88,651,395 (GRCm39) E893G probably damaging Het
Flt4 T A 11: 49,518,034 (GRCm39) L358Q probably damaging Het
Frmpd1 A G 4: 45,284,785 (GRCm39) Q1202R probably benign Het
Ghr T A 15: 3,349,879 (GRCm39) D433V possibly damaging Het
Grm7 G A 6: 111,057,383 (GRCm39) D328N possibly damaging Het
Haus4 T C 14: 54,779,577 (GRCm39) D349G probably benign Het
Helz T C 11: 107,517,542 (GRCm39) probably null Het
Hif3a A G 7: 16,790,196 (GRCm39) L69P probably damaging Het
Ifit1 A G 19: 34,625,563 (GRCm39) E233G probably damaging Het
Kcnc2 T C 10: 112,291,733 (GRCm39) F307S possibly damaging Het
Lrp1b A T 2: 41,000,771 (GRCm39) V2151E possibly damaging Het
Lrp5 T C 19: 3,709,454 (GRCm39) N92S probably damaging Het
Metrnl C T 11: 121,606,839 (GRCm39) A216V probably damaging Het
Msh2 A G 17: 88,026,217 (GRCm39) T732A probably damaging Het
Necab2 T C 8: 120,194,334 (GRCm39) L270P probably damaging Het
Noc3l T C 19: 38,804,157 (GRCm39) K74E probably benign Het
Oas2 A T 5: 120,871,537 (GRCm39) L702Q probably damaging Het
Or1j1 A T 2: 36,703,047 (GRCm39) I19N probably benign Het
Or2n1d A C 17: 38,646,731 (GRCm39) I228L possibly damaging Het
Or4k1 A G 14: 50,377,436 (GRCm39) I220T possibly damaging Het
Or4k6 C A 14: 50,475,824 (GRCm39) V173L possibly damaging Het
Pax6 A G 2: 105,525,745 (GRCm39) H376R possibly damaging Het
Pnkd C T 1: 74,390,941 (GRCm39) R376C probably damaging Het
Pnpla8 T C 12: 44,342,696 (GRCm39) F484S probably damaging Het
Psme4 T A 11: 30,782,573 (GRCm39) H909Q probably benign Het
Rasip1 CGG CGGG 7: 45,281,820 (GRCm39) probably null Het
Rbm47 A T 5: 66,182,395 (GRCm39) Y413N probably damaging Het
Rnf123 A G 9: 107,929,638 (GRCm39) probably null Het
Ruvbl1 T A 6: 88,461,412 (GRCm39) M259K possibly damaging Het
Sohlh2 A G 3: 55,097,950 (GRCm39) H134R probably benign Het
Sorbs2 A G 8: 46,248,330 (GRCm39) D447G possibly damaging Het
Tank C T 2: 61,480,573 (GRCm39) P370S probably benign Het
Tenm4 A G 7: 96,544,131 (GRCm39) E2049G probably damaging Het
Tnik A G 3: 28,648,226 (GRCm39) H426R possibly damaging Het
Trpm6 C A 19: 18,831,564 (GRCm39) S1476R possibly damaging Het
Trpm7 G A 2: 126,682,703 (GRCm39) Q389* probably null Het
Ttc28 G A 5: 111,433,095 (GRCm39) R2043Q possibly damaging Het
Tymp A G 15: 89,260,510 (GRCm39) S103P probably damaging Het
Usp40 C T 1: 87,894,901 (GRCm39) probably null Het
Vmn1r202 T A 13: 22,685,977 (GRCm39) N147Y probably damaging Het
Vmn2r89 T C 14: 51,689,688 (GRCm39) S64P probably damaging Het
Vps13a A T 19: 16,727,220 (GRCm39) D229E probably benign Het
Vps52 A G 17: 34,180,153 (GRCm39) I354V probably benign Het
Zbtb8os T C 4: 129,235,557 (GRCm39) F90L probably damaging Het
Zfp36l1 T C 12: 80,157,270 (GRCm39) D37G possibly damaging Het
Zfp467 A G 6: 48,404,751 (GRCm39) S109P unknown Het
Zzef1 T A 11: 72,728,038 (GRCm39) C535S probably damaging Het
Other mutations in Or6c216
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00990:Or6c216 APN 10 129,678,342 (GRCm39) missense probably damaging 1.00
IGL01637:Or6c216 APN 10 129,678,479 (GRCm39) missense probably benign 0.14
IGL02035:Or6c216 APN 10 129,678,659 (GRCm39) missense possibly damaging 0.95
IGL02546:Or6c216 APN 10 129,678,416 (GRCm39) missense probably damaging 0.97
R1902:Or6c216 UTSW 10 129,678,375 (GRCm39) missense probably benign
R4583:Or6c216 UTSW 10 129,678,344 (GRCm39) missense probably damaging 1.00
R4598:Or6c216 UTSW 10 129,678,864 (GRCm39) missense possibly damaging 0.92
R5196:Or6c216 UTSW 10 129,678,650 (GRCm39) missense possibly damaging 0.90
R5953:Or6c216 UTSW 10 129,678,483 (GRCm39) missense probably benign 0.22
R6311:Or6c216 UTSW 10 129,678,776 (GRCm39) missense possibly damaging 0.88
R6356:Or6c216 UTSW 10 129,678,477 (GRCm39) missense probably benign 0.14
R6499:Or6c216 UTSW 10 129,678,453 (GRCm39) missense probably benign 0.00
R9149:Or6c216 UTSW 10 129,678,482 (GRCm39) missense probably damaging 0.99
R9606:Or6c216 UTSW 10 129,678,625 (GRCm39) nonsense probably null
Predicted Primers PCR Primer
(F):5'- AACTCTGTGGACCCTAGTAGG -3'
(R):5'- AGCACATGTTCATAGAAGGACATG -3'

Sequencing Primer
(F):5'- CTCTGTGGACCCTAGTAGGAATAC -3'
(R):5'- TGATGTCTAAAATAATTGCACATTGC -3'
Posted On 2015-10-21