Mutagenetix > Incidental Mutation

Incidental Mutation 'R4714:Psme4'

353456

Institutional Source

Beutler Lab

Gene Symbol

Psme4

Ensembl Gene

ENSMUSG00000040850

Gene Name

proteasome (prosome, macropain) activator subunit 4

Synonyms

MMRRC Submission

041956-MU

Accession Numbers

Genbank: NM_134013

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R4714 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

30771726-30880361 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 30832573 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Histidine to Glutamine at position 909 (H909Q)

Ref Sequence

ENSEMBL: ENSMUSP00000045460 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000041231]

AlphaFold

Q5SSW2

Predicted Effect

probably benign
Transcript: ENSMUST00000041231
AA Change: H909Q

PolyPhen 2 Score 0.021 (Sensitivity: 0.95; Specificity: 0.80)

SMART Domains

Protein: ENSMUSP00000045460
Gene: ENSMUSG00000040850
AA Change: H909Q

Domain	Start	End	E-Value	Type
low complexity region	2	19	N/A	INTRINSIC
low complexity region	122	133	N/A	INTRINSIC
Pfam:BLM10_mid	330	828	8.8e-119	PFAM
SCOP:d1b3ua_	1183	1716	3e-14	SMART
Pfam:DUF3437	1756	1843	5.3e-39	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000142217

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000150219

Coding Region Coverage

1x: 99.1%
3x: 98.5%
10x: 97.0%
20x: 94.7%

Validation Efficiency

MGI Phenotype

PHENOTYPE: Mice homozygous for a knock-out allele show normal repair of DNA double-strand breaks but exhibit significantly reduced male fertility due to defects in spermatogenesis observed in both meiotic spermatocytes and postmeiotic haploid spermatids. [provided by MGI curators]

Allele List at MGI

All alleles(25) : Targeted, knock-out(1) Gene trapped(24)

Other mutations in this stock

Total: 65 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2700049A03Rik	G	T	12: 71,164,546	E685*	probably null	Het
2700049A03Rik	A	T	12: 71,164,547	E685V	possibly damaging	Het
4930486L24Rik	A	G	13: 60,844,318	V298A	probably damaging	Het
Abca12	A	G	1: 71,321,450	V534A	probably benign	Het
Abcb4	A	G	5: 8,930,906		probably null	Het
Adam30	A	T	3: 98,162,854	S668C	probably damaging	Het
Ap1g1	T	A	8: 109,829,620	V196D	probably damaging	Het
Atp11b	G	A	3: 35,834,394	V738I	probably benign	Het
Cast	C	T	13: 74,798,715	V27I	probably damaging	Het
Cfap54	A	G	10: 92,815,918	I3090T	probably benign	Het
Cgn	C	A	3: 94,779,438	G185W	probably damaging	Het
Champ1	T	C	8: 13,878,063	Y74H	probably damaging	Het
Cpm	T	C	10: 117,675,985	I278T	probably damaging	Het
Dcaf15	T	C	8: 84,102,216	T141A	probably benign	Het
Dcun1d1	C	T	3: 35,895,670	V244M	probably damaging	Het
Defb8	A	G	8: 19,447,559	L12P	probably damaging	Het
Dlg1	A	T	16: 31,790,261	I225F	probably damaging	Het
Dync2h1	G	T	9: 7,118,932	H2178N	possibly damaging	Het
Enam	A	G	5: 88,503,536	E893G	probably damaging	Het
Flt4	T	A	11: 49,627,207	L358Q	probably damaging	Het
Frmpd1	A	G	4: 45,284,785	Q1202R	probably benign	Het
Ghr	T	A	15: 3,320,397	D433V	possibly damaging	Het
Grm7	G	A	6: 111,080,422	D328N	possibly damaging	Het
Haus4	T	C	14: 54,542,120	D349G	probably benign	Het
Helz	T	C	11: 107,626,716		probably null	Het
Hif3a	A	G	7: 17,056,271	L69P	probably damaging	Het
Ifit1	A	G	19: 34,648,163	E233G	probably damaging	Het
Kcnc2	T	C	10: 112,455,828	F307S	possibly damaging	Het
Lrp1b	A	T	2: 41,110,759	V2151E	possibly damaging	Het
Lrp5	T	C	19: 3,659,454	N92S	probably damaging	Het
Metrnl	C	T	11: 121,716,013	A216V	probably damaging	Het
Msh2	A	G	17: 87,718,789	T732A	probably damaging	Het
Necab2	T	C	8: 119,467,595	L270P	probably damaging	Het
Noc3l	T	C	19: 38,815,713	K74E	probably benign	Het
Oas2	A	T	5: 120,733,472	L702Q	probably damaging	Het
Olfr136	A	C	17: 38,335,840	I228L	possibly damaging	Het
Olfr3	A	T	2: 36,813,035	I19N	probably benign	Het
Olfr728	A	G	14: 50,139,979	I220T	possibly damaging	Het
Olfr731	C	A	14: 50,238,367	V173L	possibly damaging	Het
Olfr812	A	T	10: 129,842,945	N32K	probably damaging	Het
Pax6	A	G	2: 105,695,400	H376R	possibly damaging	Het
Pnkd	C	T	1: 74,351,782	R376C	probably damaging	Het
Pnpla8	T	C	12: 44,295,913	F484S	probably damaging	Het
Rasip1	CGG	CGGG	7: 45,632,396		probably null	Het
Rbm47	A	T	5: 66,025,052	Y413N	probably damaging	Het
Rnf123	A	G	9: 108,052,439		probably null	Het
Ruvbl1	T	A	6: 88,484,430	M259K	possibly damaging	Het
Sohlh2	A	G	3: 55,190,529	H134R	probably benign	Het
Sorbs2	A	G	8: 45,795,293	D447G	possibly damaging	Het
Tank	C	T	2: 61,650,229	P370S	probably benign	Het
Tenm4	A	G	7: 96,894,924	E2049G	probably damaging	Het
Tnik	A	G	3: 28,594,077	H426R	possibly damaging	Het
Trpm6	C	A	19: 18,854,200	S1476R	possibly damaging	Het
Trpm7	G	A	2: 126,840,783	Q389*	probably null	Het
Ttc28	G	A	5: 111,285,229	R2043Q	possibly damaging	Het
Tymp	A	G	15: 89,376,307	S103P	probably damaging	Het
Usp40	C	T	1: 87,967,179		probably null	Het
Vmn1r202	T	A	13: 22,501,807	N147Y	probably damaging	Het
Vmn2r89	T	C	14: 51,452,231	S64P	probably damaging	Het
Vps13a	A	T	19: 16,749,856	D229E	probably benign	Het
Vps52	A	G	17: 33,961,179	I354V	probably benign	Het
Zbtb8os	T	C	4: 129,341,764	F90L	probably damaging	Het
Zfp36l1	T	C	12: 80,110,496	D37G	possibly damaging	Het
Zfp467	A	G	6: 48,427,817	S109P	unknown	Het
Zzef1	T	A	11: 72,837,212	C535S	probably damaging	Het

Other mutations in Psme4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00228:Psme4	APN	11	30815710	critical splice donor site	probably null
IGL00401:Psme4	APN	11	30821079	splice site	probably benign
IGL00475:Psme4	APN	11	30845252	missense	probably benign	0.14
IGL00576:Psme4	APN	11	30823145	missense	possibly damaging	0.50
IGL00817:Psme4	APN	11	30820129	missense	probably benign	0.01
IGL01525:Psme4	APN	11	30809936	splice site	probably benign
IGL01862:Psme4	APN	11	30812038	nonsense	probably null
IGL02310:Psme4	APN	11	30837484	missense	probably benign	0.06
IGL02477:Psme4	APN	11	30842083	missense	probably damaging	0.99
IGL02545:Psme4	APN	11	30841586	missense	possibly damaging	0.81
IGL02608:Psme4	APN	11	30820944	missense	probably benign	0.34
IGL02621:Psme4	APN	11	30848131	missense	probably benign
IGL02822:Psme4	APN	11	30848204	unclassified	probably benign
IGL02833:Psme4	APN	11	30850715	unclassified	probably benign
IGL02964:Psme4	APN	11	30791095	nonsense	probably null
IGL03273:Psme4	APN	11	30848130	missense	probably damaging	1.00
IGL03348:Psme4	APN	11	30876796	missense	probably damaging	1.00
IGL03382:Psme4	APN	11	30807788	missense	possibly damaging	0.94
H2330:Psme4	UTSW	11	30851210	missense	probably benign	0.17
PIT4378001:Psme4	UTSW	11	30821079	splice site	probably benign
R0276:Psme4	UTSW	11	30811980	missense	probably damaging	1.00
R0462:Psme4	UTSW	11	30848117	missense	probably damaging	1.00
R0685:Psme4	UTSW	11	30878415	missense	probably damaging	1.00
R0766:Psme4	UTSW	11	30807687	splice site	probably null
R0830:Psme4	UTSW	11	30807797	missense	possibly damaging	0.53
R0940:Psme4	UTSW	11	30815264	missense	possibly damaging	0.53
R1018:Psme4	UTSW	11	30804310	missense	probably damaging	1.00
R1312:Psme4	UTSW	11	30807687	splice site	probably null
R1448:Psme4	UTSW	11	30852744	missense	probably damaging	1.00
R1713:Psme4	UTSW	11	30806310	missense	probably damaging	1.00
R1732:Psme4	UTSW	11	30848105	missense	probably benign	0.03
R1813:Psme4	UTSW	11	30804353	missense	probably benign	0.14
R1905:Psme4	UTSW	11	30810922	missense	probably damaging	1.00
R1907:Psme4	UTSW	11	30810922	missense	probably damaging	1.00
R1911:Psme4	UTSW	11	30815658	missense	probably benign	0.02
R1956:Psme4	UTSW	11	30832424	missense	probably damaging	0.99
R1974:Psme4	UTSW	11	30819011	missense	probably benign	0.00
R1980:Psme4	UTSW	11	30832615	missense	possibly damaging	0.84
R1986:Psme4	UTSW	11	30830352	missense	probably benign	0.01
R2046:Psme4	UTSW	11	30817723	splice site	probably benign
R2142:Psme4	UTSW	11	30820998	missense	possibly damaging	0.89
R2698:Psme4	UTSW	11	30874282	critical splice donor site	probably null
R2844:Psme4	UTSW	11	30845173	splice site	probably benign
R3807:Psme4	UTSW	11	30856027	splice site	probably null
R3876:Psme4	UTSW	11	30856068	missense	probably damaging	0.99
R4420:Psme4	UTSW	11	30812028	missense	possibly damaging	0.67
R4584:Psme4	UTSW	11	30834318	missense	probably damaging	1.00
R4615:Psme4	UTSW	11	30834287	missense	probably benign	0.02
R5008:Psme4	UTSW	11	30856896	intron	probably benign
R5109:Psme4	UTSW	11	30791095	nonsense	probably null
R5155:Psme4	UTSW	11	30876806	missense	probably damaging	1.00
R5199:Psme4	UTSW	11	30853272	missense	probably benign	0.00
R5205:Psme4	UTSW	11	30832666	intron	probably benign
R5452:Psme4	UTSW	11	30791168	missense	probably benign
R5491:Psme4	UTSW	11	30815246	missense	possibly damaging	0.63
R5685:Psme4	UTSW	11	30809837	missense	probably damaging	0.99
R5764:Psme4	UTSW	11	30772364	intron	probably benign
R5853:Psme4	UTSW	11	30791234	critical splice donor site	probably null
R5865:Psme4	UTSW	11	30791993	missense	possibly damaging	0.95
R5903:Psme4	UTSW	11	30841589	missense	probably benign	0.28
R5927:Psme4	UTSW	11	30804294	missense	possibly damaging	0.82
R6004:Psme4	UTSW	11	30856896	intron	probably benign
R6102:Psme4	UTSW	11	30865567	missense	probably damaging	1.00
R6247:Psme4	UTSW	11	30853245	missense	possibly damaging	0.60
R6527:Psme4	UTSW	11	30832175	missense	probably benign
R6750:Psme4	UTSW	11	30853203	missense	probably damaging	1.00
R6885:Psme4	UTSW	11	30834307	nonsense	probably null
R6939:Psme4	UTSW	11	30837291	missense	probably damaging	0.99
R6945:Psme4	UTSW	11	30837437	missense	probably benign	0.06
R7029:Psme4	UTSW	11	30772474	intron	probably benign
R7049:Psme4	UTSW	11	30813904	splice site	probably null
R7098:Psme4	UTSW	11	30850661	missense	probably damaging	0.99
R7107:Psme4	UTSW	11	30848105	missense	probably benign	0.03
R7223:Psme4	UTSW	11	30874226	missense	probably benign	0.33
R7319:Psme4	UTSW	11	30807790	missense	probably benign	0.00
R7375:Psme4	UTSW	11	30772700	splice site	probably null
R7410:Psme4	UTSW	11	30815279	nonsense	probably null
R7469:Psme4	UTSW	11	30802837	missense	probably benign	0.20
R7651:Psme4	UTSW	11	30837334	missense	probably damaging	0.98
R7679:Psme4	UTSW	11	30878425	missense	probably damaging	0.99
R7681:Psme4	UTSW	11	30791975	missense	possibly damaging	0.63
R7822:Psme4	UTSW	11	30874245	missense	probably benign
R8013:Psme4	UTSW	11	30804320	missense	probably benign	0.06
R8130:Psme4	UTSW	11	30842026	missense	probably damaging	1.00
R8323:Psme4	UTSW	11	30843532	missense	probably damaging	0.99
R8330:Psme4	UTSW	11	30843583	missense	probably benign	0.00
R8363:Psme4	UTSW	11	30812139	missense	probably damaging	1.00
R8491:Psme4	UTSW	11	30772161	missense	possibly damaging	0.90
R8690:Psme4	UTSW	11	30837319	missense	probably benign	0.00
R8696:Psme4	UTSW	11	30809896	missense	probably damaging	0.99
R8743:Psme4	UTSW	11	30878467	missense	probably damaging	1.00
R8998:Psme4	UTSW	11	30838957	missense	possibly damaging	0.78
R9241:Psme4	UTSW	11	30865576	missense	probably damaging	1.00
R9657:Psme4	UTSW	11	30838980	missense	probably benign	0.00
R9736:Psme4	UTSW	11	30847411	missense	probably damaging	0.99
R9744:Psme4	UTSW	11	30815294	critical splice donor site	probably null
R9746:Psme4	UTSW	11	30876868	nonsense	probably null
V5088:Psme4	UTSW	11	30851210	missense	probably benign	0.17
X0063:Psme4	UTSW	11	30832600	missense	possibly damaging	0.66
Z1176:Psme4	UTSW	11	30843522	missense	possibly damaging	0.87
Z1177:Psme4	UTSW	11	30806311	missense	probably damaging	1.00
Z1177:Psme4	UTSW	11	30812138	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AAACAGCAGGTTGGGGTTTATATAG -3'
(R):5'- TTCTTAAAGCTACTACTTACAGGGC -3'

Sequencing Primer
(F):5'- GGCCACATACTTGATAATTCAGAAG -3'
(R):5'- GCTACTACTTACAGGGCAAACTTTC -3'

Posted On

2015-10-21