Incidental Mutation 'R4714:Pnpla8'
ID353460
Institutional Source Beutler Lab
Gene Symbol Pnpla8
Ensembl Gene ENSMUSG00000036257
Gene Namepatatin-like phospholipase domain containing 8
Synonyms1200006O19Rik, iPLA2 gamma
MMRRC Submission 041956-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.172) question?
Stock #R4714 (G1)
Quality Score225
Status Not validated
Chromosome12
Chromosomal Location44221370-44322532 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 44295913 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Serine at position 484 (F484S)
Ref Sequence ENSEMBL: ENSMUSP00000043286 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043082] [ENSMUST00000122902] [ENSMUST00000143771] [ENSMUST00000156082]
Predicted Effect probably damaging
Transcript: ENSMUST00000043082
AA Change: F484S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000043286
Gene: ENSMUSG00000036257
AA Change: F484S

DomainStartEndE-ValueType
SCOP:d1gw5a_ 332 430 2e-3 SMART
Pfam:Patatin 439 634 1.4e-26 PFAM
low complexity region 664 675 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000122902
AA Change: F266S

PolyPhen 2 Score 0.817 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000120877
Gene: ENSMUSG00000036257
AA Change: F266S

DomainStartEndE-ValueType
SCOP:d1gw5a_ 114 212 2e-3 SMART
Pfam:Patatin 221 416 3e-27 PFAM
low complexity region 446 457 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000143771
AA Change: F484S

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000122560
Gene: ENSMUSG00000036257
AA Change: F484S

DomainStartEndE-ValueType
SCOP:d1gw5a_ 332 430 3e-3 SMART
Pfam:Patatin 439 658 7.3e-17 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000156082
SMART Domains Protein: ENSMUSP00000116922
Gene: ENSMUSG00000036257

DomainStartEndE-ValueType
Pfam:Patatin 5 84 2.4e-9 PFAM
low complexity region 114 125 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000218803
AA Change: F22S
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the patatin-like phospholipase domain containing protein family. Members of this family are phospholipases which catalyze the cleavage of fatty acids from membrane phospholipids. The product of this gene is a calcium-independent phospholipase. Mutations in this gene have been associated with mitochondrial myopathy with lactic acidosis. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, May 2015]
PHENOTYPE: Mice homozygous for a null allele exhibit some female-specific embryonic lethality, reduced body weight and temperature, cold intolerance, decreased exercise tolerance and decreased mitochondria function. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700049A03Rik G T 12: 71,164,546 E685* probably null Het
2700049A03Rik A T 12: 71,164,547 E685V possibly damaging Het
4930486L24Rik A G 13: 60,844,318 V298A probably damaging Het
Abca12 A G 1: 71,321,450 V534A probably benign Het
Abcb4 A G 5: 8,930,906 probably null Het
Adam30 A T 3: 98,162,854 S668C probably damaging Het
Ap1g1 T A 8: 109,829,620 V196D probably damaging Het
Atp11b G A 3: 35,834,394 V738I probably benign Het
Cast C T 13: 74,798,715 V27I probably damaging Het
Cfap54 A G 10: 92,815,918 I3090T probably benign Het
Cgn C A 3: 94,779,438 G185W probably damaging Het
Champ1 T C 8: 13,878,063 Y74H probably damaging Het
Cpm T C 10: 117,675,985 I278T probably damaging Het
Dcaf15 T C 8: 84,102,216 T141A probably benign Het
Dcun1d1 C T 3: 35,895,670 V244M probably damaging Het
Defb8 A G 8: 19,447,559 L12P probably damaging Het
Dlg1 A T 16: 31,790,261 I225F probably damaging Het
Dync2h1 G T 9: 7,118,932 H2178N possibly damaging Het
Enam A G 5: 88,503,536 E893G probably damaging Het
Flt4 T A 11: 49,627,207 L358Q probably damaging Het
Frmpd1 A G 4: 45,284,785 Q1202R probably benign Het
Ghr T A 15: 3,320,397 D433V possibly damaging Het
Grm7 G A 6: 111,080,422 D328N possibly damaging Het
Haus4 T C 14: 54,542,120 D349G probably benign Het
Helz T C 11: 107,626,716 probably null Het
Hif3a A G 7: 17,056,271 L69P probably damaging Het
Ifit1 A G 19: 34,648,163 E233G probably damaging Het
Kcnc2 T C 10: 112,455,828 F307S possibly damaging Het
Lrp1b A T 2: 41,110,759 V2151E possibly damaging Het
Lrp5 T C 19: 3,659,454 N92S probably damaging Het
Metrnl C T 11: 121,716,013 A216V probably damaging Het
Msh2 A G 17: 87,718,789 T732A probably damaging Het
Necab2 T C 8: 119,467,595 L270P probably damaging Het
Noc3l T C 19: 38,815,713 K74E probably benign Het
Oas2 A T 5: 120,733,472 L702Q probably damaging Het
Olfr136 A C 17: 38,335,840 I228L possibly damaging Het
Olfr3 A T 2: 36,813,035 I19N probably benign Het
Olfr728 A G 14: 50,139,979 I220T possibly damaging Het
Olfr731 C A 14: 50,238,367 V173L possibly damaging Het
Olfr812 A T 10: 129,842,945 N32K probably damaging Het
Pax6 A G 2: 105,695,400 H376R possibly damaging Het
Pnkd C T 1: 74,351,782 R376C probably damaging Het
Psme4 T A 11: 30,832,573 H909Q probably benign Het
Rasip1 CGG CGGG 7: 45,632,396 probably null Het
Rbm47 A T 5: 66,025,052 Y413N probably damaging Het
Rnf123 A G 9: 108,052,439 probably null Het
Ruvbl1 T A 6: 88,484,430 M259K possibly damaging Het
Sohlh2 A G 3: 55,190,529 H134R probably benign Het
Sorbs2 A G 8: 45,795,293 D447G possibly damaging Het
Tank C T 2: 61,650,229 P370S probably benign Het
Tenm4 A G 7: 96,894,924 E2049G probably damaging Het
Tnik A G 3: 28,594,077 H426R possibly damaging Het
Trpm6 C A 19: 18,854,200 S1476R possibly damaging Het
Trpm7 G A 2: 126,840,783 Q389* probably null Het
Ttc28 G A 5: 111,285,229 R2043Q possibly damaging Het
Tymp A G 15: 89,376,307 S103P probably damaging Het
Usp40 C T 1: 87,967,179 probably null Het
Vmn1r202 T A 13: 22,501,807 N147Y probably damaging Het
Vmn2r89 T C 14: 51,452,231 S64P probably damaging Het
Vps13a A T 19: 16,749,856 D229E probably benign Het
Vps52 A G 17: 33,961,179 I354V probably benign Het
Zbtb8os T C 4: 129,341,764 F90L probably damaging Het
Zfp36l1 T C 12: 80,110,496 D37G possibly damaging Het
Zfp467 A G 6: 48,427,817 S109P unknown Het
Zzef1 T A 11: 72,837,212 C535S probably damaging Het
Other mutations in Pnpla8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00235:Pnpla8 APN 12 44283069 missense probably benign 0.00
IGL01477:Pnpla8 APN 12 44283658 missense probably damaging 0.98
IGL01963:Pnpla8 APN 12 44296033 missense possibly damaging 0.88
IGL02877:Pnpla8 APN 12 44283465 missense probably benign 0.13
IGL03085:Pnpla8 APN 12 44311522 missense probably benign 0.01
IGL03335:Pnpla8 APN 12 44283164 missense probably benign 0.03
IGL03396:Pnpla8 APN 12 44283526 missense probably benign 0.01
Bantamweight UTSW 12 44304947 missense possibly damaging 0.65
featherweight UTSW 12 44295970 nonsense probably null
freerange UTSW 12 44283247 missense possibly damaging 0.94
R0063:Pnpla8 UTSW 12 44282832 missense probably damaging 1.00
R0063:Pnpla8 UTSW 12 44282832 missense probably damaging 1.00
R0172:Pnpla8 UTSW 12 44311328 missense probably damaging 1.00
R0524:Pnpla8 UTSW 12 44283618 nonsense probably null
R0608:Pnpla8 UTSW 12 44283463 missense probably benign 0.36
R0811:Pnpla8 UTSW 12 44283405 missense probably benign 0.03
R0812:Pnpla8 UTSW 12 44283405 missense probably benign 0.03
R1120:Pnpla8 UTSW 12 44304947 missense possibly damaging 0.65
R2127:Pnpla8 UTSW 12 44308057 missense probably benign 0.37
R2392:Pnpla8 UTSW 12 44311504 missense probably damaging 1.00
R4411:Pnpla8 UTSW 12 44283442 missense probably benign 0.00
R5446:Pnpla8 UTSW 12 44290585 missense possibly damaging 0.94
R5585:Pnpla8 UTSW 12 44283064 missense probably benign 0.06
R5752:Pnpla8 UTSW 12 44282887 missense probably benign 0.04
R5914:Pnpla8 UTSW 12 44295970 nonsense probably null
R6125:Pnpla8 UTSW 12 44307989 missense possibly damaging 0.65
R6135:Pnpla8 UTSW 12 44282887 missense probably benign 0.04
R6224:Pnpla8 UTSW 12 44283028 missense possibly damaging 0.82
R6905:Pnpla8 UTSW 12 44283553 missense probably damaging 1.00
R6933:Pnpla8 UTSW 12 44283427 missense probably benign 0.00
R6983:Pnpla8 UTSW 12 44283247 missense possibly damaging 0.94
R7334:Pnpla8 UTSW 12 44311503 missense probably damaging 1.00
R7529:Pnpla8 UTSW 12 44283180 missense probably benign 0.00
R7996:Pnpla8 UTSW 12 44282983 nonsense probably null
Z1176:Pnpla8 UTSW 12 44295990 frame shift probably null
Predicted Primers PCR Primer
(F):5'- AAACTTTATATGCCCCAGTACAGG -3'
(R):5'- AAGGGATTGAAACTCACTTGAGGATC -3'

Sequencing Primer
(F):5'- TAGCATTGCAAATGTAAACGAGC -3'
(R):5'- GAAACTCACTTGAGGATCTTTTCC -3'
Posted On2015-10-21