Incidental Mutation 'R4714:4930486L24Rik'
ID353465
Institutional Source Beutler Lab
Gene Symbol 4930486L24Rik
Ensembl Gene ENSMUSG00000050345
Gene NameRIKEN cDNA 4930486L24 gene
Synonyms
MMRRC Submission 041956-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.094) question?
Stock #R4714 (G1)
Quality Score225
Status Not validated
Chromosome13
Chromosomal Location60842612-60864475 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 60844318 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 298 (V298A)
Ref Sequence ENSEMBL: ENSMUSP00000089157 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000091569] [ENSMUST00000225690]
Predicted Effect probably damaging
Transcript: ENSMUST00000091569
AA Change: V298A

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000089157
Gene: ENSMUSG00000050345
AA Change: V298A

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Inhibitor_I29 29 88 1e-19 SMART
Pept_C1 114 332 7.93e-112 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000225690
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700049A03Rik G T 12: 71,164,546 E685* probably null Het
2700049A03Rik A T 12: 71,164,547 E685V possibly damaging Het
Abca12 A G 1: 71,321,450 V534A probably benign Het
Abcb4 A G 5: 8,930,906 probably null Het
Adam30 A T 3: 98,162,854 S668C probably damaging Het
Ap1g1 T A 8: 109,829,620 V196D probably damaging Het
Atp11b G A 3: 35,834,394 V738I probably benign Het
Cast C T 13: 74,798,715 V27I probably damaging Het
Cfap54 A G 10: 92,815,918 I3090T probably benign Het
Cgn C A 3: 94,779,438 G185W probably damaging Het
Champ1 T C 8: 13,878,063 Y74H probably damaging Het
Cpm T C 10: 117,675,985 I278T probably damaging Het
Dcaf15 T C 8: 84,102,216 T141A probably benign Het
Dcun1d1 C T 3: 35,895,670 V244M probably damaging Het
Defb8 A G 8: 19,447,559 L12P probably damaging Het
Dlg1 A T 16: 31,790,261 I225F probably damaging Het
Dync2h1 G T 9: 7,118,932 H2178N possibly damaging Het
Enam A G 5: 88,503,536 E893G probably damaging Het
Flt4 T A 11: 49,627,207 L358Q probably damaging Het
Frmpd1 A G 4: 45,284,785 Q1202R probably benign Het
Ghr T A 15: 3,320,397 D433V possibly damaging Het
Grm7 G A 6: 111,080,422 D328N possibly damaging Het
Haus4 T C 14: 54,542,120 D349G probably benign Het
Helz T C 11: 107,626,716 probably null Het
Hif3a A G 7: 17,056,271 L69P probably damaging Het
Ifit1 A G 19: 34,648,163 E233G probably damaging Het
Kcnc2 T C 10: 112,455,828 F307S possibly damaging Het
Lrp1b A T 2: 41,110,759 V2151E possibly damaging Het
Lrp5 T C 19: 3,659,454 N92S probably damaging Het
Metrnl C T 11: 121,716,013 A216V probably damaging Het
Msh2 A G 17: 87,718,789 T732A probably damaging Het
Necab2 T C 8: 119,467,595 L270P probably damaging Het
Noc3l T C 19: 38,815,713 K74E probably benign Het
Oas2 A T 5: 120,733,472 L702Q probably damaging Het
Olfr136 A C 17: 38,335,840 I228L possibly damaging Het
Olfr3 A T 2: 36,813,035 I19N probably benign Het
Olfr728 A G 14: 50,139,979 I220T possibly damaging Het
Olfr731 C A 14: 50,238,367 V173L possibly damaging Het
Olfr812 A T 10: 129,842,945 N32K probably damaging Het
Pax6 A G 2: 105,695,400 H376R possibly damaging Het
Pnkd C T 1: 74,351,782 R376C probably damaging Het
Pnpla8 T C 12: 44,295,913 F484S probably damaging Het
Psme4 T A 11: 30,832,573 H909Q probably benign Het
Rasip1 CGG CGGG 7: 45,632,396 probably null Het
Rbm47 A T 5: 66,025,052 Y413N probably damaging Het
Rnf123 A G 9: 108,052,439 probably null Het
Ruvbl1 T A 6: 88,484,430 M259K possibly damaging Het
Sohlh2 A G 3: 55,190,529 H134R probably benign Het
Sorbs2 A G 8: 45,795,293 D447G possibly damaging Het
Tank C T 2: 61,650,229 P370S probably benign Het
Tenm4 A G 7: 96,894,924 E2049G probably damaging Het
Tnik A G 3: 28,594,077 H426R possibly damaging Het
Trpm6 C A 19: 18,854,200 S1476R possibly damaging Het
Trpm7 G A 2: 126,840,783 Q389* probably null Het
Ttc28 G A 5: 111,285,229 R2043Q possibly damaging Het
Tymp A G 15: 89,376,307 S103P probably damaging Het
Usp40 C T 1: 87,967,179 probably null Het
Vmn1r202 T A 13: 22,501,807 N147Y probably damaging Het
Vmn2r89 T C 14: 51,452,231 S64P probably damaging Het
Vps13a A T 19: 16,749,856 D229E probably benign Het
Vps52 A G 17: 33,961,179 I354V probably benign Het
Zbtb8os T C 4: 129,341,764 F90L probably damaging Het
Zfp36l1 T C 12: 80,110,496 D37G possibly damaging Het
Zfp467 A G 6: 48,427,817 S109P unknown Het
Zzef1 T A 11: 72,837,212 C535S probably damaging Het
Other mutations in 4930486L24Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01138:4930486L24Rik APN 13 60854859 missense probably benign 0.00
IGL01325:4930486L24Rik APN 13 60853533 missense probably damaging 1.00
IGL02290:4930486L24Rik APN 13 60853530 missense probably damaging 1.00
IGL02861:4930486L24Rik APN 13 60853332 splice site probably benign
PIT4514001:4930486L24Rik UTSW 13 60853514 critical splice donor site probably null
R0110:4930486L24Rik UTSW 13 60853506 splice site probably benign
R1396:4930486L24Rik UTSW 13 60853243 missense probably benign 0.00
R1471:4930486L24Rik UTSW 13 60853522 missense probably damaging 1.00
R1688:4930486L24Rik UTSW 13 60854881 missense probably benign 0.00
R1697:4930486L24Rik UTSW 13 60845114 missense probably damaging 1.00
R3838:4930486L24Rik UTSW 13 60845227 missense probably damaging 1.00
R4976:4930486L24Rik UTSW 13 60853573 nonsense probably null
R5072:4930486L24Rik UTSW 13 60853600 missense probably benign 0.00
R5107:4930486L24Rik UTSW 13 60853658 missense possibly damaging 0.62
R5699:4930486L24Rik UTSW 13 60853596 missense possibly damaging 0.92
R6092:4930486L24Rik UTSW 13 60853647 missense probably benign 0.01
R6787:4930486L24Rik UTSW 13 60853108 missense probably benign
R6800:4930486L24Rik UTSW 13 60845134 missense probably damaging 1.00
R7349:4930486L24Rik UTSW 13 60842903 missense possibly damaging 0.52
R7390:4930486L24Rik UTSW 13 60844338 missense probably benign 0.00
R7580:4930486L24Rik UTSW 13 60845226 missense probably damaging 0.97
R7589:4930486L24Rik UTSW 13 60842933 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTGCATTCAACCTCTAGGGGATG -3'
(R):5'- ATGAAGACTCTTGTTCCATCTTACC -3'

Sequencing Primer
(F):5'- CATTCAACCTCTAGGGGATGTAGAG -3'
(R):5'- ATACCTCTCTTACATGTTGATGAGG -3'
Posted On2015-10-21