Incidental Mutation 'R4714:Olfr728'
ID353467
Institutional Source Beutler Lab
Gene Symbol Olfr728
Ensembl Gene ENSMUSG00000050030
Gene Nameolfactory receptor 728
SynonymsMOR246-1P, GA_x6K02T2PMLR-5831021-5830086
MMRRC Submission 041956-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.327) question?
Stock #R4714 (G1)
Quality Score225
Status Not validated
Chromosome14
Chromosomal Location50133758-50142680 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 50139979 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 220 (I220T)
Ref Sequence ENSEMBL: ENSMUSP00000149796 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051563] [ENSMUST00000213163] [ENSMUST00000213685] [ENSMUST00000215327] [ENSMUST00000215451]
Predicted Effect possibly damaging
Transcript: ENSMUST00000051563
AA Change: I220T

PolyPhen 2 Score 0.553 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000052079
Gene: ENSMUSG00000050030
AA Change: I220T

DomainStartEndE-ValueType
Pfam:7tm_4 31 304 9.8e-43 PFAM
Pfam:7TM_GPCR_Srx 31 304 9.8e-7 PFAM
Pfam:7TM_GPCR_Srsx 35 297 6.5e-9 PFAM
Pfam:7tm_1 41 287 1e-18 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000213163
Predicted Effect possibly damaging
Transcript: ENSMUST00000213685
AA Change: I220T

PolyPhen 2 Score 0.553 (Sensitivity: 0.88; Specificity: 0.91)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000214046
Predicted Effect probably benign
Transcript: ENSMUST00000215327
Predicted Effect noncoding transcript
Transcript: ENSMUST00000215329
Predicted Effect probably benign
Transcript: ENSMUST00000215451
Predicted Effect noncoding transcript
Transcript: ENSMUST00000216423
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.7%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700049A03Rik G T 12: 71,164,546 E685* probably null Het
2700049A03Rik A T 12: 71,164,547 E685V possibly damaging Het
4930486L24Rik A G 13: 60,844,318 V298A probably damaging Het
Abca12 A G 1: 71,321,450 V534A probably benign Het
Abcb4 A G 5: 8,930,906 probably null Het
Adam30 A T 3: 98,162,854 S668C probably damaging Het
Ap1g1 T A 8: 109,829,620 V196D probably damaging Het
Atp11b G A 3: 35,834,394 V738I probably benign Het
Cast C T 13: 74,798,715 V27I probably damaging Het
Cfap54 A G 10: 92,815,918 I3090T probably benign Het
Cgn C A 3: 94,779,438 G185W probably damaging Het
Champ1 T C 8: 13,878,063 Y74H probably damaging Het
Cpm T C 10: 117,675,985 I278T probably damaging Het
Dcaf15 T C 8: 84,102,216 T141A probably benign Het
Dcun1d1 C T 3: 35,895,670 V244M probably damaging Het
Defb8 A G 8: 19,447,559 L12P probably damaging Het
Dlg1 A T 16: 31,790,261 I225F probably damaging Het
Dync2h1 G T 9: 7,118,932 H2178N possibly damaging Het
Enam A G 5: 88,503,536 E893G probably damaging Het
Flt4 T A 11: 49,627,207 L358Q probably damaging Het
Frmpd1 A G 4: 45,284,785 Q1202R probably benign Het
Ghr T A 15: 3,320,397 D433V possibly damaging Het
Grm7 G A 6: 111,080,422 D328N possibly damaging Het
Haus4 T C 14: 54,542,120 D349G probably benign Het
Helz T C 11: 107,626,716 probably null Het
Hif3a A G 7: 17,056,271 L69P probably damaging Het
Ifit1 A G 19: 34,648,163 E233G probably damaging Het
Kcnc2 T C 10: 112,455,828 F307S possibly damaging Het
Lrp1b A T 2: 41,110,759 V2151E possibly damaging Het
Lrp5 T C 19: 3,659,454 N92S probably damaging Het
Metrnl C T 11: 121,716,013 A216V probably damaging Het
Msh2 A G 17: 87,718,789 T732A probably damaging Het
Necab2 T C 8: 119,467,595 L270P probably damaging Het
Noc3l T C 19: 38,815,713 K74E probably benign Het
Oas2 A T 5: 120,733,472 L702Q probably damaging Het
Olfr136 A C 17: 38,335,840 I228L possibly damaging Het
Olfr3 A T 2: 36,813,035 I19N probably benign Het
Olfr731 C A 14: 50,238,367 V173L possibly damaging Het
Olfr812 A T 10: 129,842,945 N32K probably damaging Het
Pax6 A G 2: 105,695,400 H376R possibly damaging Het
Pnkd C T 1: 74,351,782 R376C probably damaging Het
Pnpla8 T C 12: 44,295,913 F484S probably damaging Het
Psme4 T A 11: 30,832,573 H909Q probably benign Het
Rasip1 CGG CGGG 7: 45,632,396 probably null Het
Rbm47 A T 5: 66,025,052 Y413N probably damaging Het
Rnf123 A G 9: 108,052,439 probably null Het
Ruvbl1 T A 6: 88,484,430 M259K possibly damaging Het
Sohlh2 A G 3: 55,190,529 H134R probably benign Het
Sorbs2 A G 8: 45,795,293 D447G possibly damaging Het
Tank C T 2: 61,650,229 P370S probably benign Het
Tenm4 A G 7: 96,894,924 E2049G probably damaging Het
Tnik A G 3: 28,594,077 H426R possibly damaging Het
Trpm6 C A 19: 18,854,200 S1476R possibly damaging Het
Trpm7 G A 2: 126,840,783 Q389* probably null Het
Ttc28 G A 5: 111,285,229 R2043Q possibly damaging Het
Tymp A G 15: 89,376,307 S103P probably damaging Het
Usp40 C T 1: 87,967,179 probably null Het
Vmn1r202 T A 13: 22,501,807 N147Y probably damaging Het
Vmn2r89 T C 14: 51,452,231 S64P probably damaging Het
Vps13a A T 19: 16,749,856 D229E probably benign Het
Vps52 A G 17: 33,961,179 I354V probably benign Het
Zbtb8os T C 4: 129,341,764 F90L probably damaging Het
Zfp36l1 T C 12: 80,110,496 D37G possibly damaging Het
Zfp467 A G 6: 48,427,817 S109P unknown Het
Zzef1 T A 11: 72,837,212 C535S probably damaging Het
Other mutations in Olfr728
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01101:Olfr728 APN 14 50140054 missense probably benign 0.06
IGL02080:Olfr728 APN 14 50140122 missense probably damaging 1.00
IGL03187:Olfr728 APN 14 50139800 missense probably damaging 0.98
R1613:Olfr728 UTSW 14 50140294 missense probably damaging 1.00
R1671:Olfr728 UTSW 14 50139833 missense probably damaging 1.00
R1876:Olfr728 UTSW 14 50140172 missense probably damaging 0.99
R2085:Olfr728 UTSW 14 50140123 missense probably damaging 1.00
R2086:Olfr728 UTSW 14 50140123 missense probably damaging 1.00
R2158:Olfr728 UTSW 14 50140123 missense probably damaging 1.00
R2226:Olfr728 UTSW 14 50140619 missense probably damaging 1.00
R2516:Olfr728 UTSW 14 50139983 missense probably benign
R4454:Olfr728 UTSW 14 50140496 missense probably benign 0.00
R4754:Olfr728 UTSW 14 50140033 missense possibly damaging 0.90
R4754:Olfr728 UTSW 14 50140034 missense probably benign 0.02
R5275:Olfr728 UTSW 14 50140496 missense probably benign 0.35
R5339:Olfr728 UTSW 14 50140302 missense probably damaging 0.96
R6614:Olfr728 UTSW 14 50140364 missense probably damaging 1.00
R6713:Olfr728 UTSW 14 50139724 missense probably benign
R6900:Olfr728 UTSW 14 50139838 missense possibly damaging 0.94
R7062:Olfr728 UTSW 14 50140450 missense probably damaging 1.00
R7192:Olfr728 UTSW 14 50140120 missense possibly damaging 0.48
R7528:Olfr728 UTSW 14 50139820 missense possibly damaging 0.93
R7740:Olfr728 UTSW 14 50140346 missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- CAATTTCCTCAAGGCTGATTTCAC -3'
(R):5'- CAGTGAATCTGCCATTCTGTG -3'

Sequencing Primer
(F):5'- AAGGCTGATTTCACATCTTCATTTC -3'
(R):5'- GGTCCCAATGAGGTAGATAGCTTC -3'
Posted On2015-10-21